scholarly journals An RNA Hairpin to G-Quadruplex Conformational Transition

2012 ◽  
Vol 134 (49) ◽  
pp. 19953-19956 ◽  
Author(s):  
Anthony Bugaut ◽  
Pierre Murat ◽  
Shankar Balasubramanian
Keyword(s):  
Conformational Transition ◽  
G Quadruplex ◽  
Rna Hairpin

scholarly journals Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

2020 ◽  
Vol 48 (3) ◽  
pp. 1120-1130 ◽  
Author(s):  
Zi-Fu Wang ◽  
Ming-Hao Li ◽  
I-Te Chu ◽  
Fernaldo R Winnerdy ◽  
Anh T Phan ◽  
...  
Keyword(s):  
Conformational Transition ◽  
Epigenetic Modification ◽  
Slight Modification ◽  
Proton Nuclear Magnetic Resonance ◽  
Time Resolved ◽  
Imino Proton ◽  
Nuclear Magnetic Resonance Spectra ◽  
G Quadruplex ◽  
State Transition Model ◽  
Cytosine Modification

Abstract Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

scholarly journals Conformational Transition of a Hairpin Structure to G-Quadruplex within the WNT1 Gene Promoter

2014 ◽  
Vol 137 (1) ◽  
pp. 210-218 ◽  
Author(s):  
Margaret Hsin-Jui Kuo ◽  
Zi-Fu Wang ◽  
Ting-Yuan Tseng ◽  
Ming-Hao Li ◽  
Shang-Te Danny Hsu ◽  
...  
Keyword(s):  
Conformational Transition ◽  
Gene Promoter ◽  
Hairpin Structure ◽  
G Quadruplex

Visual detection of mercury(ii) based on recognition of the G-quadruplex conformational transition by a cyanine dye supramolecule

The Analyst ◽  
2015 ◽  
Vol 140 (21) ◽  
pp. 7170-7174 ◽  
Author(s):  
Hongbo Chen ◽  
Xiufeng Zhang ◽  
Hongxia Sun ◽  
Xiaoran Sun ◽  
Yunhua Shi ◽  
...  
Keyword(s):  
Visual Detection ◽  
Conformational Transition ◽  
Cyanine Dye ◽  
G Quadruplex

Visual detection of mercury(ii) based on recognition of the G-quadruplex conformational transition by a cyanine dye supramolecule is reported.

A supramolecular probe for colorimetric detection of Pb2+ based on recognition of G-quadruplex

RSC Advances ◽  
2015 ◽  
Vol 5 (3) ◽  
pp. 1730-1734 ◽  
Author(s):  
Hongbo Chen ◽  
Hongxia Sun ◽  
Xiufeng Zhang ◽  
Xiaoran Sun ◽  
Yunhua Shi ◽  
...  
Keyword(s):  
Conformational Transition ◽  
Colorimetric Detection ◽  
Colorimetric Probe ◽  
G Quadruplex

A colorimetric probe of Pb2+ has been designed based on the mechanism that a supramolecular probe selectively recognized the Pb2+-induced conformational transition of G-quadruplexes.

Constant pH Molecular Dynamics Reveals How Proton Release Drives the Conformational Transition of a Transmembrane Efflux Pump

2017 ◽  
Author(s):  
Jana Shen ◽  
Zhi Yue ◽  
Helen Zgurskaya ◽  
Wei Chen
Keyword(s):  
Molecular Dynamics ◽  
Conformational Changes ◽  
Transmembrane Domain ◽  
Conformational Transition ◽  
Conformational Dynamics ◽  
Proton Release ◽  
Intrinsic Resistance ◽  
Constant Ph ◽  
Wide Range ◽  
Constant Ph Molecular Dynamics

AcrB is the inner-membrane transporter of E. coli AcrAB-TolC tripartite efflux complex, which plays a major role in the intrinsic resistance to clinically important antibiotics. AcrB pumps a wide range of toxic substrates by utilizing the proton gradient between periplasm and cytoplasm. Crystal structures of AcrB revealed three distinct conformational states of the transport cycle, substrate access, binding and extrusion, or loose (L), tight (T) and open (O) states. However, the specific residue(s) responsible for proton binding/release and the mechanism of proton-coupled conformational cycling remain controversial. Here we use the newly developed membrane hybrid-solvent continuous constant pH molecular dynamics technique to explore the protonation states and conformational dynamics of the transmembrane domain of AcrB. Simulations show that both Asp407 and Asp408 are deprotonated in the L/T states, while only Asp408 is protonated in the O state. Remarkably, release of a proton from Asp408 in the O state results in large conformational changes, such as the lateral and vertical movement of transmembrane helices as well as the salt-bridge formation between Asp408 and Lys940 and other sidechain rearrangements among essential residues.Consistent with the crystallographic differences between the O and L protomers, simulations offer dynamic details of how proton release drives the O-to-L transition in AcrB and address the controversy regarding the proton/drug stoichiometry. This work offers a significant step towards characterizing the complete cycle of proton-coupled drug transport in AcrB and further validates the membrane hybrid-solvent CpHMD technique for studies of proton-coupled transmembrane proteins which are currently poorly understood. <p><br></p>

Sign in / Sign up

Export Citation Format

Share Document