A supramolecular probe for colorimetric detection of Pb2+ based on recognition of G-quadruplex

RSC Advances ◽  
2015 ◽  
Vol 5 (3) ◽  
pp. 1730-1734 ◽  
Author(s):  
Hongbo Chen ◽  
Hongxia Sun ◽  
Xiufeng Zhang ◽  
Xiaoran Sun ◽  
Yunhua Shi ◽  
...  
Keyword(s):  
Conformational Transition ◽  
Colorimetric Detection ◽  
Colorimetric Probe ◽  
G Quadruplex

A colorimetric probe of Pb2+ has been designed based on the mechanism that a supramolecular probe selectively recognized the Pb2+-induced conformational transition of G-quadruplexes.

Colorimetric detection of cholesterol with G-quadruplex-based DNAzymes and ABTS2−

2012 ◽  
Vol 724 ◽  
pp. 80-85 ◽  
Author(s):  
Ruimin Li ◽  
Cen Xiong ◽  
Zhiyou Xiao ◽  
Liansheng Ling
Keyword(s):  
Colorimetric Detection ◽  
G Quadruplex

Colorimetric detection of hypochlorite based on the morphological changes of silver nanoprisms to spherical nanoparticles

2017 ◽  
Vol 9 (21) ◽  
pp. 3151-3158 ◽  
Author(s):  
Thangarasu Sasikumar ◽  
Malaichamy Ilanchelian
Keyword(s):  
Quantitative Determination ◽  
Morphological Changes ◽  
Colorimetric Detection ◽  
Colorimetric Method ◽  
Spherical Nanoparticles ◽  
Colorimetric Probe ◽  
Silver Nanoprisms

In this work, we have developed a simple, rapid, sensitive and selective colorimetric method for the quantitative determination of hypochlorite (ClO−) ions by using triangular silver nanoprisms (AgNPRs) as a colorimetric probe.

A G-quadruplex DNAzyme-based LAMP biosensing platform for a novel colorimetric detection ofListeria monocytogenes

2018 ◽  
Vol 10 (8) ◽  
pp. 848-854 ◽  
Author(s):  
Zhanmin Liu ◽  
Chenhui Yao ◽  
Yanming Wang ◽  
Cuiyun Yang
Keyword(s):  
Listeria Monocytogenes ◽  
Visual Detection ◽  
Colorimetric Detection ◽  
G Quadruplex ◽  
Oflisteria Monocytogenes ◽  
Cascade Amplification

A LAMP-based method for the visual detection ofListeria monocytogeneshas been developed by employing DNAzyme-catalyzed cascade amplification of the colorimetric signal.

Ag+–3,3′,5,5′-tetramethylbenzidine as a probe for colorimetric detection of ascorbic acid in beverages

2020 ◽  
Vol 44 (5) ◽  
pp. 1772-1776 ◽  
Author(s):  
Xin Shu ◽  
Yongren Chen ◽  
Chunling Yuan ◽  
Yilin Wang
Keyword(s):  
Ascorbic Acid ◽  
Colorimetric Detection ◽  
Colorimetric Probe ◽  
Sensitive Method

A novel and sensitive method for ascorbic acid (AA) determination utilizing Ag+–3,3′,5,5′-tetramethylbenzidine (TMB) as a colorimetric probe was proposed.

Hyaluronan–tyrosine–gold nanoparticles as an enzyme-free colorimetric probe for the detection of phosphorothiolate pesticides

2017 ◽  
Vol 9 (43) ◽  
pp. 6139-6147 ◽  
Author(s):  
Limin Yang ◽  
Xiaohui Zhang ◽  
Huiping Li ◽  
Lei Jiang
Keyword(s):  
Gold Nanoparticles ◽  
Colorimetric Detection ◽  
Colorimetric Probe ◽  
Simple Strategy

A simple strategy for colorimetric detection of OPPs with P–S bonds was proposed, requiring only the addition of analyte into the HA–Tyr–AuNP solution.

scholarly journals Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

2020 ◽  
Vol 48 (3) ◽  
pp. 1120-1130 ◽  
Author(s):  
Zi-Fu Wang ◽  
Ming-Hao Li ◽  
I-Te Chu ◽  
Fernaldo R Winnerdy ◽  
Anh T Phan ◽  
...  
Keyword(s):  
Conformational Transition ◽  
Epigenetic Modification ◽  
Slight Modification ◽  
Proton Nuclear Magnetic Resonance ◽  
Time Resolved ◽  
Imino Proton ◽  
Nuclear Magnetic Resonance Spectra ◽  
G Quadruplex ◽  
State Transition Model ◽  
Cytosine Modification

Abstract Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Malonamide dithiocarbamate functionalized gold nanoparticles for colorimetric sensing of Cu2+ and Hg2+ ions

RSC Advances ◽  
2015 ◽  
Vol 5 (6) ◽  
pp. 4245-4255 ◽  
Author(s):  
Vaibhavkumar N. Mehta ◽  
Suresh Kumar Kailasa
Keyword(s):  
Gold Nanoparticles ◽  
Colorimetric Detection ◽  
Colorimetric Sensing ◽  
Au Nps ◽  
Colorimetric Probe ◽  
Functionalized Gold Nanoparticles

In this study, a colorimetric probe was developed based on malonamide dithiocarbamate functionalized gold nanoparticles (MA–DTC–Au NPs) for the simultaneous colorimetric detection of Cu2+ and Hg2+ ions.

Sign in / Sign up

Export Citation Format

Share Document