Visual detection of mercury(ii) based on recognition of the G-quadruplex conformational transition by a cyanine dye supramolecule

The Analyst ◽  
2015 ◽  
Vol 140 (21) ◽  
pp. 7170-7174 ◽  
Author(s):  
Hongbo Chen ◽  
Xiufeng Zhang ◽  
Hongxia Sun ◽  
Xiaoran Sun ◽  
Yunhua Shi ◽  
...  
Keyword(s):  
Visual Detection ◽  
Conformational Transition ◽  
Cyanine Dye ◽  
G Quadruplex

Visual detection of mercury(ii) based on recognition of the G-quadruplex conformational transition by a cyanine dye supramolecule is reported.

Visual detection of potassium by a cyanine dye supramolecular aggregate responsive to G-quadruplex motif transition

The Analyst ◽  
2012 ◽  
Vol 137 (24) ◽  
pp. 5713 ◽  
Author(s):  
Hongxia Sun ◽  
Junfeng Xiang ◽  
Wei Gai ◽  
Qian Shang ◽  
Qian Li ◽  
...  
Keyword(s):  
Visual Detection ◽  
Cyanine Dye ◽  
Supramolecular Aggregate ◽  
G Quadruplex

A cyanine dye supramolecular FRET switch driven by G-quadruplex to monitor mitophagy

2021 ◽  
pp. 109429
Author(s):  
Xiaomeng Guo ◽  
Dawei Yang ◽  
Ranran Sun ◽  
Qian Li ◽  
Hongyan Du ◽  
...  
Keyword(s):  
Cyanine Dye ◽  
G Quadruplex

The development of a light-up red-emitting fluorescent probe based on a G-quadruplex specific cyanine dye

RSC Advances ◽  
2016 ◽  
Vol 6 (74) ◽  
pp. 70117-70123 ◽  
Author(s):  
Xing Chen ◽  
Jine Wang ◽  
Guimei Jiang ◽  
Guangyue Zu ◽  
Min Liu ◽  
...  
Keyword(s):  
Fluorescent Probe ◽  
Cyanine Dye ◽  
Polymethine Chain ◽  
G Quadruplex

Cyanine dye-dimethylindole red containing an anionic propylsulfonate substituent and an extending polymethine chain was found to behave as a highly specific red-emitting G-quadruplex probe, especially for parallel G-quadruplex c-myc.

A G-quadruplex DNAzyme-based LAMP biosensing platform for a novel colorimetric detection ofListeria monocytogenes

2018 ◽  
Vol 10 (8) ◽  
pp. 848-854 ◽  
Author(s):  
Zhanmin Liu ◽  
Chenhui Yao ◽  
Yanming Wang ◽  
Cuiyun Yang
Keyword(s):  
Listeria Monocytogenes ◽  
Visual Detection ◽  
Colorimetric Detection ◽  
G Quadruplex ◽  
Oflisteria Monocytogenes ◽  
Cascade Amplification

A LAMP-based method for the visual detection ofListeria monocytogeneshas been developed by employing DNAzyme-catalyzed cascade amplification of the colorimetric signal.

Reversible regulation of the supramolecular chirality of a cyanine dye by using the G-quadruplex structure as a template

2016 ◽  
Vol 52 (45) ◽  
pp. 7302-7305 ◽  
Author(s):  
Yunhua Shi ◽  
Hongxia Sun ◽  
Junfeng Xiang ◽  
Hongbo Chen ◽  
Suge Zhang ◽  
...  
Keyword(s):  
Cyanine Dye ◽  
Quadruplex Structure ◽  
Supramolecular Chirality ◽  
G Quadruplex ◽  
Multiple Cycle ◽  
Cycle Regulation

Multiple cycle regulation of the supramolecular chirality of a cyanine dye has been successfully achieved by using DNA G-quadruplexes as templates, which is easily controllable by repeated addition of Ag+ and cysteine (Cys).

127 Selective G-quadruplex recognition by a novel cyanine dye

2015 ◽  
Vol 33 (sup1) ◽  
pp. 81-82
Author(s):  
Pallavi Chilka ◽  
Prathap Reddy Patlolla ◽  
Bhaskar Datta
Keyword(s):  
Cyanine Dye ◽  
G Quadruplex

scholarly journals Visual detection of Fusarium proliferatum based on asymmetric recombinase polymerase amplification and hemin/G-quadruplex DNAzyme

RSC Advances ◽  
2019 ◽  
Vol 9 (64) ◽  
pp. 37144-37147 ◽  
Author(s):  
Ying Wang ◽  
Xiangdong Li ◽  
Dongmei Xi ◽  
Xiaoqiang Wang
Keyword(s):  
Visual Detection ◽  
Fusarium Proliferatum ◽  
Recombinase Polymerase Amplification ◽  
G Quadruplex

Asymmetric recombinase polymerase amplification and hemin/G-quadruplex DNAzyme-based visual detection of F. proliferatum is demonstrated.

scholarly journals Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

2020 ◽  
Vol 48 (3) ◽  
pp. 1120-1130 ◽  
Author(s):  
Zi-Fu Wang ◽  
Ming-Hao Li ◽  
I-Te Chu ◽  
Fernaldo R Winnerdy ◽  
Anh T Phan ◽  
...  
Keyword(s):  
Conformational Transition ◽  
Epigenetic Modification ◽  
Slight Modification ◽  
Proton Nuclear Magnetic Resonance ◽  
Time Resolved ◽  
Imino Proton ◽  
Nuclear Magnetic Resonance Spectra ◽  
G Quadruplex ◽  
State Transition Model ◽  
Cytosine Modification

Abstract Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Sign in / Sign up

Export Citation Format

Share Document