scholarly journals Conformational Transition of a Hairpin Structure to G-Quadruplex within the WNT1 Gene Promoter

2014 ◽  
Vol 137 (1) ◽  
pp. 210-218 ◽  
Author(s):  
Margaret Hsin-Jui Kuo ◽  
Zi-Fu Wang ◽  
Ting-Yuan Tseng ◽  
Ming-Hao Li ◽  
Shang-Te Danny Hsu ◽  
...  
Keyword(s):  
Conformational Transition ◽  
Gene Promoter ◽  
Hairpin Structure ◽  
G Quadruplex

scholarly journals Up-Regulating Relaxin Expression by G-Quadruplex Interactive Ligand to Achieve Antifibrotic Action

Endocrinology ◽  
2012 ◽  
Vol 153 (8) ◽  
pp. 3692-3700 ◽  
Author(s):  
Hui-Ping Gu ◽  
Sen Lin ◽  
Ming Xu ◽  
Hai-Yi Yu ◽  
Xiao-Jun Du ◽  
...  
Keyword(s):  
Rna Polymerase Ii ◽  
Cardiac Fibrosis ◽  
Cardiac Fibroblasts ◽  
Heart Diseases ◽  
Gene Promoter ◽  
Binding Motif ◽  
Endogenous Expression ◽  
G Quadruplex

Myocardial fibrosis is a key pathological change in a variety of heart diseases contributing to the development of heart failure, arrhythmias, and sudden death. Recent studies have shown that relaxin prevents and reverses cardiac fibrosis. Endogenous expression of relaxin was elevated in the setting of heart disease; the extent of such up-regulation, however, is insufficient to exert compensatory actions, and the mechanism regulating relaxin expression is poorly defined. In the rat relaxin-1 (RLN1, Chr1) gene promoter region we found presence of repeated guanine (G)-rich sequences, which allowed formation and stabilization of G-quadruplexes with the addition of a G-quadruplex interactive ligand berberine. The G-rich sequences and the G-quadruplexes were localized adjacent to the binding motif of signal transducer and activator of transcription (STAT)3, which negatively regulates relaxin expression. Thus, we hypothesized that the formation and stabilization of G-quadruplexes by berberine could influence relaxin expression. We found that berberine-induced formation of G-quadruplexes did increase relaxin gene expression measured at mRNA and protein levels. Formation of G-quadruplexes significantly reduced STAT3 binding to the promoter of relaxin gene. This was associated with consequent increase in the binding of RNA polymerase II and STAT5a to relaxin gene promoter. In cardiac fibroblasts and rats treated with angiotensin II, berberine was found to suppress fibroblast activation, collagen synthesis, and extent of cardiac fibrosis through up-regulating relaxin. The antifibrotic action of berberine in vitro and in vivo was similar to that by exogenous relaxin. Our findings document a novel therapeutic strategy for fibrosis through up-regulating expression of endogenous relaxin.

scholarly journals Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter

2020 ◽  
Vol 48 (3) ◽  
pp. 1120-1130 ◽  
Author(s):  
Zi-Fu Wang ◽  
Ming-Hao Li ◽  
I-Te Chu ◽  
Fernaldo R Winnerdy ◽  
Anh T Phan ◽  
...  
Keyword(s):  
Conformational Transition ◽  
Epigenetic Modification ◽  
Slight Modification ◽  
Proton Nuclear Magnetic Resonance ◽  
Time Resolved ◽  
Imino Proton ◽  
Nuclear Magnetic Resonance Spectra ◽  
G Quadruplex ◽  
State Transition Model ◽  
Cytosine Modification

Abstract Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

scholarly journals An RNA Hairpin to G-Quadruplex Conformational Transition

2012 ◽  
Vol 134 (49) ◽  
pp. 19953-19956 ◽  
Author(s):  
Anthony Bugaut ◽  
Pierre Murat ◽  
Shankar Balasubramanian
Keyword(s):  
Conformational Transition ◽  
G Quadruplex ◽  
Rna Hairpin

scholarly journals The hTERT core promoter forms three parallel G-quadruplexes

2020 ◽  
Vol 48 (10) ◽  
pp. 5720-5734 ◽  
Author(s):  
Robert C Monsen ◽  
Lynn DeLeeuw ◽  
William L Dean ◽  
Robert D Gray ◽  
T Michael Sabo ◽  
...  
Keyword(s):  
Molecular Dynamics ◽  
Molecular Dynamics Simulations ◽  
Core Promoter ◽  
Hairpin Structure ◽  
Htert Promoter ◽  
Wild Type ◽  
Wild Type Sequence ◽  
G Quadruplex ◽  
Dynamics Simulations ◽  
Type Sequence

Abstract The structure of the 68 nt sequence with G-quadruplex forming potential within the hTERT promoter is disputed. One model features a structure with three stacked parallel G-quadruplex units, while another features an unusual duplex hairpin structure adjoined to two stacked parallel and antiparallel quadruplexes. We report here the results of an integrated structural biology study designed to distinguish between these possibilities. As part of our study, we designed a sequence with an optimized hairpin structure and show that its biophysical and biochemical properties are inconsistent with the structure formed by the hTERT wild-type sequence. By using circular dichroism, thermal denaturation, nuclear magnetic resonance spectroscopy, analytical ultracentrifugation, small-angle X-ray scattering, molecular dynamics simulations and a DNase I cleavage assay we found that the wild type hTERT core promoter folds into a stacked, three-parallel G-quadruplex structure. The hairpin structure is inconsistent with all of our experimental data obtained with the wild-type sequence. All-atom models for both structures were constructed using molecular dynamics simulations. These models accurately predicted the experimental hydrodynamic properties measured for each structure. We found with certainty that the wild-type hTERT promoter sequence does not form a hairpin structure in solution, but rather folds into a compact stacked three-G-quadruplex conformation.

Sign in / Sign up

Export Citation Format

Share Document