ASSOCIATION OF CD14 (C-159T) GENE POLYMORPHISM AND IRRITATED INTESTINE SYNDROME WITH OBESITY

The purpose of the study – to study the association of the polymorphic variant C-159Tof the CD14 gene in patients with irritable bowel syndrome (IBS) depending on thepredominance of diarrhea or constipation in the clinical course and the relationshipbetween genotypes of the CD14 gene (C-159T) and some blood parameters.Material and methods. The study involved 90 patients with IBS (30 men and 60women aged 22 to 56 years). The polymorphic variant of the CD 14 gene (C-159T)was analyzed by polymerase chain reaction in 90 patients with IBS without and withconcomitant obesity and 30 people in the comparison group. Blood levels of C-reactiveprotein (CRP), tumor necrosis factor α (TNFα), transforming growth factor β1(TGFβ1), interleukin-10 (IL-10), 8-isoprostane, ceruloplasmin, medium molecules andcalprotectin levels in feces were determined.Results. In patients with IBS and obesity, the frequency of TT genotype (36.7%) washigher compared to healthy subjects (TT genotype – 13.3%). Significantly higherserum levels of CRP (3.5 times and 26.7%), TNFα (1.7 times and 19.5%), TGFβ1(29.8% and 19.2%), 8-isoprostane (54.1% and 31.9%), ceruloplasmin (56.7% and33.0%), medium molecules (7, 5% and 12.9%) and calprotectin (55.7% and 37.4%) inthe feces compared to the CC and CT genotype have been determined in patients withIBS, combined with obesity, TT genotype with a predominance of diarrhea.Conclusions. The association of a polymorphic variant of the CD14 (C-159T) gene withthe risk of IBS development in obese patients has been established. The TT genotype ischaracterized by a higher content of proinflammatory cytokines (TNFα), lower levelsof anti-inflammatory cytokines (IL-10), increased CRP, more pronounced changesin the prooxidant and antioxidant blood systems (higher levels of 8-isoprostane andceruloplasmin, local inflammation (increase in calprotectin content) and severity ofendotoxicosis (higher content of medium molecules).

ASSOCIATION OF POLYMORPHISM rs2569190 OF THE GENE CD14 WITH ANKYLOSING SPONDILITIS

Ankylosing spondylitis is a chronic rheumatological disease of unknown etiology. The search for new genetic associations will improve understanding of pathogenesis. Objective: to study the association of the rs2569190 polymorphism of the CD14 gene with ankylosing spondylitis in the European population of the Krasnoyarsk region. The study recruited 3 groups of patients: the first - with ankylosing spondylitis (AS) (n = 150), the second group - patients with the rest of seronegative spondyloarthritis (SPA) (n = 66), the third group included conditionally healthy patients (control group) (n = 226). The clinical assessment of patients with SPA was based on Russian federal clinical guidelines, including the calculation of the BASDAI, BASFI and HAQ indices. DNA isolation was performed using the standard phenol-chloroform method. Genotyping for the CD14 gene was performed by PCR (polymerase chain reaction) – RFLP (restriction fragment length polymorphism) analysis. PCR was performed with a set of primers (forward GCTGAGGTTCGGAGAAGTTGC; reverse GGTGCCAACAGATGAGGTTCAC) followed by restriction with Bme18I. PCR products were analyzed by electrophoresis in 4% polyacrylamide gel followed by staining with ethidium bromide. Comparative analysis of the group of patients with AS and the control group revealed a statistically significant prevalence of the TT genotype rs2569190 in the main group (34.7% versus 23.9%) (p = 0.0236; OR 1.6901; 95% CI OR 1.0728-2.6625). Patients with seronegative SPA did not demonstrate the significant disparities in rs2569190. In Krasnoyarsk region europids, the TT genotype of the rs2569190 polymorphism was associated with ankylosing spondylitis but not with seronegative SPA. The identification of a new association confirms the influence of other genetic factors on the predisposition to AS. It is likely that some of the genetic factors play a role in the pathogenesis under the influence of the external environment. Identification of these associations will make it possible to adjust the lifestyle of patients and their relatives to reduce the risk of exacerbation or development of AS.

Mutations in CD14 gene may have significant effect on mastitis resistance/susceptibility of buffalo.

Background: CD14 is an important pattern recognition receptor having innate immune function and has antibacterial activity. It binds with LPS of gram-negative bacteria, arachidonic acid, and lipoteichoic acid. Being a receptor, it binds with the pathogen with the help of other cytokines. Mutations in CD14 affect the binding ability which in turn affects the biological potentiality. Method: The present study was conducted on 228 nos. of buffaloes pertaining to four different breeds as Murrah, Mehsana, Surti and Bhadawari. CD14 gene was characterized and polymorphism was detected through Single nucleotide conformation polymorphism. Association study was conducted for different variants of CD14 with mastitis in buffalo, detected through somatic cell count, california mastitis test.Result:Eight variants of CD14 were detected and mutational hotspots were detected in bubaline CD14 with 58 number of non-synonymous SNP, out of which 18 were observed to be deleterious and 34 as thermodynamically unstable. In the present study, we had detected the mutations in CD14 gene and its association with the somatic cell score and other indicators for mastitis. In-silico studies were conducted to understand the molecular mechanism how the mutations affect the biological potentiality by analyzing different domains and structural analysis along with various post-translational modification sites.Conclusion: Deleterious mutations were observed in CD14 gene which have significant effect on mastitis of buffalo. It may be employed for marker assisted selection, therapeutic application of recombinant CD14, gene therapy, transgenic or gene edited animal production with wild type CD14 resistant to mastitis as future strategy.

Mutations in CD14 gene may have significant effect on mastitis resistance/susceptibility of buffalo.

Background: CD14 is an important pattern recognition receptor having innate immune function and has antibacterial activity. It binds with LPS of gram-negative bacteria, arachidonic acid, and lipoteichoic acid. Being a receptor, it binds with the pathogen with the help of other cytokines. Mutations in CD14 affect the binding ability which in turn affects the biological potentiality. Method: The present study was conducted on 228 nos. of buffaloes pertaining to four different breeds as Murrah, Mehsana, Surti and Bhadawari. CD14 gene was characterized and polymorphism was detected through Single nucleotide conformation polymorphism. Association study was conducted for different variants of CD14 with mastitis in buffalo, detected through somatic cell count, california mastitis test.Result: Eight variants of CD14 were detected and mutational hotspots were detected in bubaline CD14 with 58 number of non-synonymous SNP, out of which 18 were observed to be deleterious and 34 as thermodynamically unstable. In the present study, we had detected the mutations in CD14 gene and its association with the somatic cell score and other indicators for mastitis. In-silico studies were conducted to understand the molecular mechanism how the mutations affect the biological potentiality by analyzing different domains and structural analysis along with various post-translational modification sites.Conclusion: Deleterious mutations were observed in CD14 gene which have significant effect on mastitis of buffalo. It may be employed for marker assisted selection, therapeutic application of recombinant CD14, gene therapy, transgenic or gene edited animal production with wild type CD14 resistant to mastitis as future strategy.

CD14 Gene (−159 C>T) Polymorphism and its Surface Expression on Monocytes in Pulmonary Tuberculosis Patients

BACKGROUND: Tuberculosis (TB) is an infectious disease that affects millions of people around the world. The innate immune response against TB starts by interaction of several receptors on monocytes with mycobacterium tuberculosis (MTB). CD14 is one of these receptors present on the monocytes which facilitate the entry of MTB into the cell. Certain polymorphisms in CD14 gene, for example, CD14 (−159 C>T) in the promotor region have suggested susceptibility of TB. AIM: This study was designed to determine and compare CD14 (−159 C>T) gene polymorphism and its surface expression in pulmonary TB patients (before and during anti-TB treatment) and healthy controls. MATERIALS AND METHODS: The study population comprised three groups (pulmonary TB patients before treatment, pulmonary TB patients during treatment, and healthy controls) whereas 53 blood samples were collected from each group. The percentage of monocytes and CD14 mean fluorescence intensity (MFI) was measured by flow cytometry whereas polymerase chain reaction-restriction fragment length polymorphism was used to determine gene polymorphism. RESULTS: CD14 MFI was significantly high in healthy controls than in TB patients (432 as compared to 193 and 365, p < 0.0001). There was no significant difference in CD14 single nucleotide polymorphism allele frequencies or genotypes between TB patients and healthy controls. CONCLUSION: CD14 gene (−159 C>T) polymorphism was not associated with pulmonary TB disease in a sample of Pakistani population and surface expression of CD14 receptor on peripheral blood monocytes decreases with active TB disease and during treatment.

Mutations in CD14 gene may have significant effect on mastitis resistance/susceptibility of buffalo.

Background: CD14 is an important pattern recognition receptor having innate immune function and has antibacterial activity. It binds with LPS of gram-negative bacteria, arachidonic acid, and lipoteichoic acid. Being a receptor, it binds with the pathogen with the help of other cytokines. Mutations in CD14 affect the binding ability which in turn affects the biological potentiality. Method: The present study was conducted on 228 nos. of buffaloes pertaining to four different breeds as Murrah, Mehsana, Surti and Bhadawari. CD14 gene was characterized and polymorphism was detected through Single nucleotide conformation polymorphism. Association study was conducted for different variants of CD14 with mastitis in buffalo, detected through somatic cell count, california mastitis test. Result: Eight variants of CD14 were detected and mutational hotspots were detected in bubaline CD14 with 58 number of non-synonymous SNP, out of which 18 were observed to be deleterious and 34 as thermodynamically unstable. In the present study, we had detected the mutations in CD14 gene and its association with the somatic cell score and other indicators for mastitis. In-silico studies were conducted to understand the molecular mechanism how the mutations affect the biological potentiality by analyzing different domains and structural analysis along with various post-translational modification sites. Conclusion: Deleterious mutations were observed in CD14 gene which have significant effect on mastitis of buffalo. It may be employed for marker assisted selection, therapeutic application of recombinant CD14, gene therapy, transgenic animal production with wild type CD14 resistant to mastitis as future strategy. Keywords: CD14, cytokine, bio-informatics, mutation, SNP, deleterious, I-mutant, Provean, mastitis

SNP Diversity in CD14 Gene Promoter Suggests Adaptation Footprints in Trypanosome Tolerant N’Dama (Bos taurus) but not in Susceptible White Fulani (Bos indicus) Cattle

Immune response to infections has been shown to be mediated by genetic diversity in pattern recognition receptors, leading to disease tolerance or susceptibility. We elucidated naturally occurring variations within the bovine CD14 gene promoter in trypanosome-tolerant (N’Dama) and susceptible (White Fulani) cattle, with genomic and computational approaches. Blood samples were collected from White Fulani and N’Dama cattle, genomic DNA extracted and the entire promoter region of the CD14 gene amplified by PCR. We sequenced this region and performed in silico computation to identify SNP variants, transcription factor binding sites, as well as micro RNAs in the region. CD14 promoter sequences were compared with the reference bovine genome from the Ensembl database to identify various SNPs. Furthermore, we validated three selected N’Dama specific SNPs using custom Taqman SNP genotyping assay for genetic diversity. In all, we identified a total of 54 and 41 SNPs at the CD14 promoter for N’Dama and White Fulani respectively, including 13 unique SNPs present in N’Dama only. The significantly higher SNP density at the CD14 gene promoter region in N’Dama may be responsible for disease tolerance, possibly an evolutionary adaptation. Our genotype analysis of the three loci selected for validation show that mutant alleles (A/A, C/C, and A/A) were adaptation profiles within disease tolerant N’Dama. A similar observation was made for our haplotype analysis revealing that haplotypes H1 (ACA) and H2 (ACG) were significant combinations within the population. The SNP effect prediction revealed 101 and 89 new transcription factor binding sites in N’Dama and White Fulani, respectively. We conclude that disease tolerant N’Dama possessing higher SNP density at the CD14 gene promoter and the preponderance of mutant alleles potentially confirms the significance of this promoter in immune response, which is lacking in susceptible White Fulani. We, therefore, recommend further in vitro and in vivo study of this observation in infected animals, as the next step for understanding genetic diversity relating to varying disease phenotypes in both breeds.