First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using ‘root dip inoculation’ and ‘soil inoculation’ technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Comparative Analysis Delineates the Transcriptional Resistance Mechanisms for Pod Borer Resistance in the Pigeonpea Wild Relative Cajanus scarabaeoides (L.) Thouars

Insect pests pose a serious threat to global food production. Pod borer (Helicoverpa armigera (Hübner)) is one of the most destructive pests of leguminous crops. The use of host resistance has been an effective, environmentally friendly and sustainable approach for controlling several agricultural pests. The exploitation of natural variations in crop wild relatives could yield pest-resistant crop varieties. In this study, we used a high-throughput transcriptome profiling approach to investigate the defense mechanisms of susceptible cultivated and tolerant wild pigeonpea genotypes against H. armigera infestation. The wild genotype displayed elevated pest-induced gene expression, including the enhanced induction of phytohormone and calcium/calmodulin signaling, transcription factors, plant volatiles and secondary metabolite genes compared to the cultivated control. The biosynthetic and regulatory processes associated with flavonoids, terpenes and glucosinolate secondary metabolites showed higher accumulations in the wild genotype, suggesting the existence of distinct tolerance mechanisms. This study provides insights into the molecular mechanisms underlying insect resistance in the wild pigeonpea genotype. This information highlights the indispensable role of crop wild relatives as a source of crucial genetic resources that could be important in devising strategies for crop improvement with enhanced pest resistance.

A Wild Cajanus scarabaeoides (L.), Thouars, IBS 3471, for Improved Insect-Resistance in Cultivated Pigeonpea

Cajanus scarabaeoides (L.), Thouars, is the closest wild crop relative of cultivated pigeonpea, Cajanus cajan (L.), Millspaugh. This wild pigeonpea has several insect-resistance mechanisms, particularly to Helicoverpa armigera (Hübner). Estimated economic losses in the semi-arid tropics from H. armigera damage in pigeonpea are approximately two billion USD/year. Therefore, it is imperative to improve pest resistance in this crop. In this study, we investigated insect-resistance components in IBS 3471, a C. scarabaeoides accession, and explored the possibility of transferring resistance mechanism/s to cultivated pigeonpea. A detached leaf bioassay revealed that IBS 3471 has more effective antibiosis and antixenosis resistance mechanisms against H. armigera compared to the susceptible C. cajan variety, ICPL 87. To further investigate the antibiosis resistance mechanism, we fed H. armigera larvae a heated and non-heated artificial diet supplemented with lyophilised IBS 3471 leaf powder. Incorporation of IBS 3471 leaf powder inhibited H. armigera larval weight and delayed larval development compared to larvae reared on diet supplemented with ICPL 87 leaf powder. The putative insect-resistance compounds in C. scarabaeoides were heat-labile. Proteomic analysis revealed higher levels of potential insecticidal proteins, namely lectin and cysteine proteinase inhibitor, in wild pigeonpea compared to the cultivated variety. Nutritional analysis and interspecific hybridisation experiments also indicated that IBS 3471 is a potential candidate for improvement of insect-resistance in pigeonpea. This study demonstrates that IBS 3471 has multiple resistance mechanisms against H. armigera, and they are transferable to cultivated pigeonpea.

Investigation of Insect Resistance Components in Wild Pigeonpea Cajanus Scarabaeoides

Cajanus scarabaeoides (L.) Thouars is the closest wild relative of cultivated pigeonpea, Cajanus cajan (L.) Millspaugh. However, unlike cultivated pigeonpea which is very susceptible to insects, especially Helicoverpa armigera (Hubner), this wild pigeonpea is strongly insect resistant. Since H. armigera causes damage to many important crops resulting in economic losses up to 2 billion USD/year, improvement in resistance to this insect in crops is highly desirable. Here we investigate insect resistance components in C. scarabaeoides and explore the possibility of transferring one or more of those factors to cultivated pigeonpea. A detached leaf assay was used to assess antibiosis and antixenosis resistance mechanisms in C. scarabaeoides. Artificial diet supplemented with lyophilised leaf powder was employed to investigate the antibiosis resistance mechanism. Data on larval mortality and larval and pupal weights were collected. Time taken for neonate larvae to pupate and for pupae to develop to the moth stage were determined through daily observations. Preliminary results showed that H. armigera larval weight was significantly reduced and larval development stages were prolonged when reared on different accessions of C. scarabaeoides as compared to the susceptible check, C. cajan (ICPL 87). Interspecific hybridization was carried out between C. scarabaeoides and a commercial pigeonpea variety. Results from insect challenge assays and trichome identification indicate that the hybrids have similar levels of insect resistance to their wild parent. Proteomic analysis is being used to identify possible antibiosis factors.