A new real-time PCR assay for detecting fungi in genus Ceratocystis

The genus Ceratocystis contains several significant plant pathogens, causing wilt and canker disease on a wide range of plants species. Currently, there are over 40 known species of Ceratocystis, some of which are becoming increasingly important in agricultural or natural ecosystems. The diagnostics for most Ceratocystis species currently relies on time consuming and labour-intensive culturing approaches. To provide more time efficient and sensitive molecular diagnostic tools for Ceratocystis, a generic Taq-Man real-time PCR assay was developed using the ITS gene. This novel two-probe Taq-man assay amplified DNA from all tested Ceratocystis species. Some non-specific amplification of a few species from closely related genera was observed under certain conditions; however, these false positive detections could be ruled out using the additional PCR primers developed for further sequence based identification of the detected species. The assay was highly sensitive as it detected 0.2 pg/µl of Ceratocystis DNA in water as well as in host DNA matrix. Further validation with artificially inoculated fig stem tissue demonstrated that the assay was also able to effectively detect the pathogen in infected asymptomatic stem tissue. This newly developed real-time PCR assay has practical applications in biosecurity, conservation, and agriculture, enabling to detect Ceratocystis species directly from plant material, to facilitate more sensitive screening of imported plant germplasm, and allow rapid tracking of pathogens in case of disease outbreaks.

Transcriptomics of different tissues of blueberry and diversity analysis of rhizosphere fungi under cadmium stress

Blueberry (Vaccinium ssp.) is a perennial shrub belonging to the family Ericaceae, which is highly tolerant of acid soils and heavy metal pollution. In the present study, blueberry was subjected to cadmium (Cd) stress in simulated pot culture. The transcriptomics and rhizosphere fungal diversity of blueberry were analyzed, and the iron (Fe), manganese (Mn), copper (Cu), zinc (Zn) and cadmium (Cd) content of blueberry tissues, soil and DGT was determined. A correlation analysis was also performed. A total of 84 374 annotated genes were identified in the root, stem, leaf and fruit tissue of blueberry, of which 3370 were DEGs, and in stem tissue, of which 2521 were DEGs. The annotation data showed that these DEGs were mainly concentrated in a series of metabolic pathways related to signal transduction, defense and the plant–pathogen response. Blueberry transferred excess Cd from the root to the stem for storage, and the highest levels of Cd were found in stem tissue, consistent with the results of transcriptome analysis, while the lowest Cd concentration occurred in the fruit, Cd also inhibited the absorption of other metal elements by blueberry. A series of genes related to Cd regulation were screened by analyzing the correlation between heavy metal content and transcriptome results. The roots of blueberry rely on mycorrhiza to absorb nutrients from the soil. The presence of Cd has a significant effect on the microbial community composition of the blueberry rhizosphere. The fungal family Coniochaetaceae, which is extremely extremelytolerant, has gradually become the dominant population. The results of this study increase our understanding of the plant regulation mechanism for heavy metals, and suggest potential methods of soil remediation using blueberry.

Comparative Transcriptomic Analysis Identifies Key Cellulose Synthase Genes (CESA) and Cellulose Synthase-Like Genes (CSL) in Bast Fiber Development Stage of Flax (Linum Usitatissimum L.)

Background: The cellulose synthase gene superfamily, including the cellulose synthase (CESA) and cellulose synthase-like (CSL) gene families, is vital for cell wall construction during plant growth, particularly for fiber development of flax, which is an old and important fiber crop. Results: This study performed a sequencing search of key CESA and CSL genes from several flax stem parts at different fiber development stages by comparing RNA-Seq. Quantitative RT-PCR was used to validate the expression of these genes. This study revealed that CESA4 genes (Lus10008225.g and Lus10008226.g), CESA6 genes (Lus10006161.g and Lus10041063.g), CESA8 genes (Lus10007296.g and Lus10029245.g), CSLD4 gene (Lus10026568.g), CSLE1 (Lus10016625.g) and CSLG genes (Lus10023056.g and Lus10023057.g) were specifically expressed in stem tissue below the snap point where fibers is increased amounts of secondary cell wall deposition. LusCESA4 genes, LusCESA8, genes and LusCSLD4 gene were specifically expressed in fiber development stage during the fast growth period of flax plants. Based on GO and KEGG analyses, it was found that genes involved in pathways of cellulose microfibril organization, galactosyl transferase activity and galactose metabolism were specifically enriched in the stem tissue of the fiber development stage. Other genes involved in cellulose biosynthesis were also analyzed and discussed. Conclusion: The results of this study will provide an important foundation for understanding fiber cell wall biogenesis, particularly the roles of LusCESAs and LusCSLs in the process of fiber development.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using ‘root dip inoculation’ and ‘soil inoculation’ technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Effect of Temperature Treatments on the Viability of Clavibacter sepedonicus in Infected Potato Tissue

The objective of the present study was to establish whether exposure to temperatures of 55-70 °C results in eradication of the pathogen Clavibacter sepedonicus (Cs) in colonised potato tissue, in order to evaluate the efficiency of composting for disinfection of Cs-infected potato waste. Pre-sprouted potato tubers were inoculated and planted to produce Cs-colonised stem and tuber material. After incubation in temperature-controlled water baths, the infected potato tissue was analysed for the presence of culturable and pathogenic Cs. Additional experiments were performed with Cs-colonised potato stem tissue crushed and deaerated, thus simulating macerated stem tissue in the compost heap. To enable a comparison with bacterial cells that are not enclosed by their natural organic matrix, temperature treatments were applied to non-infected stem tissue crushed and deaerated, and spiked with freshly prepared Cs-suspensions. Cs settled inside colonised potato tissue, as well as Cs present as Cs-suspensions supplemented to potato tissue, was eradicated by exposure to heat, even after a treatment of 1 h at 55 °C, with the exception of one case in which the pathogen present in intact stem material escaped a treatment of 6 h at 60 °C, indicating that incidentally stems may provide niches in which the pathogen is protected against heat.

Localization and Composition of Fructans in Stem and Rhizome of Agave tequilana Weber var. azul

Methodology combining mass spectrometry imaging (MSI) with ion mobility separation (IMS) has emerged as a biological imaging technique due to its versatility, sensitivity and label-free approach. This technique has been shown to separate isomeric compounds such as lipids, amino acids, carboxylic acids and carbohydrates. This report describes mass spectrometry imaging in combination with traveling-wave ion mobility separation and matrix-assisted laser desorption/ionization (MALDI). Positive ionization mode was used to locate fructans on tissue printed sections of Agave rhizome and stem tissue and distinguished fructan isoforms. Here we show the location of fructans ranging from DP3 to DP17 to be differentially abundant across the stem tissue and for the first time, experimental collision cross sections of endogenous fructan structures have been collected, revealing at least two isoforms for fructans of DP4, DP5, DP6, DP7, DP8, DP10, and DP11. This demonstrates that complex fructans such as agavins can be located and their isoforms resolved using a combination of MALDI, IMS, and MSI, without the need for extraction or derivatization. Use of this methodology uncovered patterns of fructan localization consistent with functional differences where higher DP fructans are found toward the central section of the stem supporting a role in long term carbohydrate storage whereas lower DP fructans are concentrated in the highly vascularized central core of rhizomes supporting a role in mobilization of carbohydrates from the mother plant to developing offsets. Tissue specific patterns of expression of genes encoding enzymes involved in fructan metabolism are consistent with fructan structures and localization.

Long-Term Cd Exposure Alters the Metabolite Profile in Stem Tissue of Medicago sativa

As a common pollutant, cadmium (Cd) is one of the most toxic heavy metals accumulating in agricultural soils through anthropogenic activities. The uptake of Cd by plants is the main entry route into the human food chain, whilst in plants it elicits oxidative stress by unbalancing the cellular redox status. Medicago sativa was subjected to chronic Cd stress for five months. Targeted and untargeted metabolic analyses were performed. Long-term Cd exposure altered the amino acid composition with levels of asparagine, histidine and proline decreasing in stems but increasing in leaves. This suggests tissue-specific metabolic stress responses, which are often not considered in environmental studies focused on leaves. In stem tissue, profiles of secondary metabolites were clearly separated between control and Cd-exposed plants. Fifty-one secondary metabolites were identified that changed significantly upon Cd exposure, of which the majority are (iso)flavonoid conjugates. Cadmium exposure stimulated the phenylpropanoid pathway that led to the accumulation of secondary metabolites in stems rather than cell wall lignification. Those metabolites are antioxidants mitigating oxidative stress and preventing cellular damage. By an adequate adjustment of its metabolic composition, M. sativa reaches a new steady state, which enables the plant to acclimate under chronic Cd stress.

Oxalate and silica contents of seven varieties of Napier grass (Pennisetum purpureum)

Oxalate and silica are considered antinutrients. Large quantities of oxalate and silica in plants can interfere with the uptake of essential minerals in ruminants. Therefore, the aim of this study was to compare the total silica and oxalate contents of seven varieties of Napier grass to find out which is best for cultivation. Taiwan, Zanzibar, Pakchong, Purple, Kobe, Indian, and Dwarf Napier grass were grown in a completely randomized design with three replications to determine their soluble oxalate, total oxalate, and silica contents. Plants were harvested at two months of plant maturity. Whole plant of the Dwarf Napier grass contained significantly higher soluble oxalate content than tall varieties. Total oxalate content in whole plant differed significantly among varieties. Dwarf showed the highest total oxalate content (3.23% dry matter (DM)) followed by Kobe (2.61%), Zanzibar (2.60%), Purple (2.44%), Taiwan (2.43%), Indian (2.15%), and Pakchong (1.95%). Regardless of variety, leaf tissue contained significantly higher soluble oxalate and total oxalate than stem tissue. There were no differences in silica content among them. In conclusion, the tall varieties could produce lower levels of soluble oxalate than the Dwarf variety, whereas silica content might not vary among them.Keywords: botanical fractions, mineral bioavailability, ruminant

Comparison of Cold Hardiness Evaluation of Woody Species by ELLT and TTCLT

Cold hardiness evaluation is important for screening woody species in cold areas. We compared cold hardiness by estimating the 50% lethal temperature (LT50) using electrolyte leakage test (ELLT50) and triphenyltetrazolium chloride test (TTCLT50) for 26 woody species in the Bashang region of China. One-year-old shoots were collected in January and exposed to five subfreezing temperatures in a programmable temperature and humidity chamber. LT50 was estimated by fitting relative electrolyte leakage and percentage of dead tissue against test temperature. For all tested species, triphenyltetrazolium chloride (TTC) staining of the pith was weak and the cambium TTCLT50 was lower than the extreme minimum temperature (−37 °C) recorded in the region. The cambium TTCLT50 and the sd were lower than that for the phloem and xylem. The phloem TTCLT50 was lower than the xylem TTCLT50, and the two sds were similar. The ELLT50 showed no significant correlation with any TTCLT50. For most species, the ELLT50 was higher than the cambium and phloem TTCLT50 and was not significant different with the xylem TTCLT50. The ELLT50 showed higher sd than any tissue TTCLT50. Based on results obtained in this study, when choosing cold hardiness of single stem tissue as an indicator for screening woody species, the xylem should be considered first, followed by the phloem; the cambium and pith were unsuitable. The cold hardiness estimated by ELLT50 was more suitable as indicator for screening woody species than that of stem tissue in winter estimated by TTCLT50.