Distribution, Ecology, Chemistry and Toxicology of Plant Stinging Hairs

Plant stinging hairs have fascinated humans for time immemorial. True stinging hairs are highly specialized plant structures that are able to inject a physiologically active liquid into the skin and can be differentiated from irritant hairs (causing mechanical damage only). Stinging hairs can be classified into two basic types: Urtica-type stinging hairs with the classical “hypodermic syringe” mechanism expelling only liquid, and Tragia-type stinging hairs expelling a liquid together with a sharp crystal. In total, there are some 650 plant species with stinging hairs across five remotely related plant families (i.e., belonging to different plant orders). The family Urticaceae (order Rosales) includes a total of ca. 150 stinging representatives, amongst them the well-known stinging nettles (genus Urtica). There are also some 200 stinging species in Loasaceae (order Cornales), ca. 250 stinging species in Euphorbiaceae (order Malphigiales), a handful of species in Namaceae (order Boraginales), and one in Caricaceae (order Brassicales). Stinging hairs are commonly found on most aerial parts of the plants, especially the stem and leaves, but sometimes also on flowers and fruits. The ecological role of stinging hairs in plants seems to be essentially defense against mammalian herbivores, while they appear to be essentially inefficient against invertebrate pests. Stinging plants are therefore frequent pasture weeds across different taxa and geographical zones. Stinging hairs are usually combined with additional chemical and/or mechanical defenses in plants and are not a standalone mechanism. The physiological effects of stinging hairs on humans vary widely between stinging plants and range from a slight itch, skin rash (urticaria), and oedema to sharp pain and even serious neurological disorders such as neuropathy. Numerous studies have attempted to elucidate the chemical basis of the physiological effects. Since the middle of the 20th century, neurotransmitters (acetylcholine, histamine, serotonin) have been repeatedly detected in stinging hairs of Urticaceae, but recent analyses of Loasaceae stinging hair fluids revealed high variability in their composition and content of neurotransmitters. These substances can explain some of the physiological effects of stinging hairs, but fail to completely explain neuropathic effects, pointing to some yet unidentified neurotoxin. Inorganic ions (e.g., potassium) are detected in stinging hairs and could have synergistic effects. Very recently, ultrastable miniproteins dubbed “gympietides” have been reported from two species of Dendrocnide, arguably the most violently stinging plant. Gympietides are shown to be highly neurotoxic, providing a convincing explanation for Dendrocnide toxicity. For the roughly 648 remaining stinging plant species, similarly convincing data on toxicity are still lacking.

INJECTIONS: First Do No Harm (History of Injections)

Injections are one of the most common, effective, reliable and low cost medical/ health care procedures accepted all around the world. Indeed, there are few medical tools so common and yet so indispensable, as the plastic disposable syringe and needle. However, it took thousands of years for injections to get to where it is today. This review article would trace the evolution of syringe from ancient times to the present and would also highlight about the possible risk of infections related to unsafe disposal of used syringes and needles and injection safety.The word “syringe” is derived from the Greek word syrinx, meaning “tube”. The structure and design of syringe is quite simple and yet effective as a medical tool. A syringe is like a simple pump with a tight plunger that fits into a cylindrical tube. The plunger can be pulled and pushed allowing the syringe to pull in or push out a liquid or gas through the open end of the tube that may be attached with a hypodermic needle.The first syringes were used in Roman times (1st Century AD) and are mentioned in a journal called De Medicina as being used to treat medical complications. Simple piston syringes were used to deliver ointments and creams were described by Galen (129-200 CE). An Egyptian, Ammar bin Ali al-Mawsilli was reported using glass tubes for suction for cataract extraction from about 900 CE. In 1650 Blaise Pascal’s experimental work in hydraulics led him to invent the first modern syringe which allowed the infusion of medicines. By 1660 Esholttz and Drs Major used injections on humans with fatal results due to ignorance of suitable dosage and the need for sterilization and infusion. Hence the disastrous consequences of these experiments delayed the use of injections for around 200 years. An Irish physician named Francis Rynd invented the hollow needle and used it to make the first recorded subcutaneous injections in 1844. In 1853 Charles Pravaz and Alexander Wood developed a medical hypodermic syringe with a needle fine enough to pierce a skin. Alexander Wood injected morphine into humans to treat nerve conditions and his wife subsequently became addicted to morphine and is recorded as the first woman to die of an injected drug overdose.In 1899 Letitia Mumford Geer of New York was granted a patent for a syringe design that permitted the user to operate it one-handed.In 1946 Chance Brothers in England made the first all-glass syringe with an interchangeable barrel and plunge and this was revolutionary as mass-sterilization of different components became possible without needing to match up the individual parts. Then shortly thereafter Australian inventor Charles Rotha user created the world’s first plastic, disposable hypodermic syringe made from polyethylene in 1949. Two years later he produced the first injection-molded syringes made of polypropylene, a plastic that can be heat-sterilized. Then in 1956 a New Zealand pharmacist and inventor Colin Murdoch got patents for disposable plastic syringe followed by Becton Dickinson in 1961 and an African American inventor Phil received a US patent for a “Disposable Syringe”.The basic design has remained unchanged though interchangeable parts and the use of plastic resulted in universal use of disposable syringes and needles since the mid-1950s. The syringe has become an indispensable instrument for many aspects of interventional medicine and everyday practice.

Cross-sectional field trial to assess the efficacy of restricted application of deltamethrin 1% ready to use formulation: To adapt and develop cost-effective tsetse control strategy to be applied in Ethiopia

BackgroundProbability-based observational study design was used to collect the baseline data, data to isolate changes occurring overtime and data on last monitoring in which sampling involved stratified random selection of sampling units, since the surveying area is heterogeneous, at the outset, the area was isolated into subareas (strata) based on vegetation, climate, altitude, land use, distribution of human habitation, etc. into more or less homogeneous. Different trap traps design baited with odor attractants were deployed in a georeferenced locaitons. Then, animals were treated with deltamethrin 1%, using hypodermic syringe, at belly and legs body parts, as 0.06 ml of formulation per 1 kg of body weight which is less by 40% that needed for a whole body treatment regime The data processing was carried out based on quantitative data analyzing methods.Results The result of subsequent monitoring surveys depicted that the overall tsetse mean catch reduced by 78.6% from a mean catch of 17.3 ± 8.6 flies per trap per day of pre-control to 3.7 ± 2.6 flies per trap per day at last monitoring. And the reduction was found statistically significant; p=0.000. Consequentially, the overall mean trypanosome prevalence was dropped from a peak of 63 cases (11.6% ± 3.2) in November 2017 to the current level of 17 cases (3.9% ± 2.3) in June 2019. This resulted in a 66.4% reduction in which the difference was found statistically significant; p=0.000. The overall mean PCV value has also improved by 1.5% from 24.9%±3.2 of the reference data to 26.4% ± 3.4 at last monitoring and the difference was found statistically significant; p=0.002. ConclusionAs the findings of this field trial have proved, generally, insecticide-based control technique is one of the most reliable simplest techniques to rapidly suppress tsetse flies. Its cost effectiveness greatly enhances when it is applied in restricted application scenario. The technique has got a potential not only to reduce the amount of insecticide needed for the whole body application regimen by 40%, but also a potential to adequately suppress tsetse flies consequentially, trypanosomosis.

Investigation of the Transfer of Septum Microbial Contamination by Hypodermic Needles

The likelihood of the transfer of microbial contamination from the surface of a vial septum into the vial liquid, by penetration of a hypodermic syringe needle, has been investigated. Experimental work was carried out with vials containing sterile microbial growth media and the use of needles of three different diameters. Three different concentrations of microbes on the surface of the vial septum (10, 100, and 1000) were used. Microbial contamination that was transferred into the growth media was determined by incubation of the vials following penetration of the septum by the needles. Contamination was detected in 87% of all the vials tested, and was generally found to increase as the concentration of septum challenge organisms and needle diameter increased. Key words: Septum seals, hypodermic needles, multi-use vials, microbial contamination

A Brief History of Local Anesthesia

ABSTRACT Mankind has, throughout its existence, been engaged in the quest to control the pain associated with disease and trauma. Evidence from over 4500 years ago demonstrates the Egyptians use of methods to compress peripheral nerves. Homer's Iliad relates the use of herbal remedies for pain control. Other early writings describe the use of electricity generated by the Torpedo ray for pain control as well as cold water and ice for pain reduction. These techniques, in their various incarnations, comprised the main armamentarium of local pain control until the early 1800's when the early framework for the hypodermic syringe emerged in America. Cocaine, noted for its stimulant effect as well as numbing properties, was first brought to Europe by Vespucci. The combination of a workable syringe and the purification of Cocaine by Niemann essentially gave birth to modern local anesthesia. Halsted would perform the first injections of cocaine via hypodermic syringe into a proximal nerve for distal pain control, introducing modern conduction local anesthesia. All that remained was the introduction of numerous blockers of nerve depolarization, combined with vasoconstrictors, to minimize systemic toxicity, and we arrive at the modern state of local anesthesia. How to cite this article Nathan J, Asadourian L, Erlich MA. A Brief History of Local Anesthesia. Int J Head Neck Surg 2016; 7(1):29-32.

The Sign Of The Four

Sherlock Holmes took his bottle from the corner of the mantelpiece, and his hypodermic syringe from its neat morocco case. With his long, white, nervous fingers he adjusted the delicate needle, and rolled back his left shirt-cuff. For some little time his eyes rested...

Phenotypic and genotypic characterization of Xanthomonas campestris strains isolated from cabbage, kale and broccoli

Thirty-six strains of Xanthomonas campestris pv. campestris (Xcc) isolated from cabbage, kale and broccoli were identified according to their pathogenicity, phenotypic and genotypic characterization. Pathogenicity was confirmed by the injection method with a hypodermic syringe into the mesophilic tissue of cabbage leaves. All strains were Gramnegative, aerobic, catalase-positive, oxidase-negative, grew at 35?C, produced levan, H2S and indole, did not reduce nitrate, hydrolyzed Tween 80, starch, gelatin and esculin and did not show tolerance to 0.1 and 0.02% TTC. The strains produced acid from d-arabinose, arginine, dulcitol, galactose, d-glucose, maltose, mannose, sorbitol, sucrose and xylose. The genetic characterization was based on the sequence analyses of 16S rDNA and ERIC and BOX PCR. Strains of different pathovars were also used to compare PCR resulting patterns. BOX-PCR of the strains from kale and broccoli, obtained using (GTG)5 primer, yielded patterns with a high similarity level to pathovar reference strain Xcc. The strains from cabbage yielded BOX and ERIC product patterns, distinguishing them from the other tested strains and reference strains. 16S rDNA of the representative strains was closely related to Xcc strain ATCC 33913. ERIC PCR and BOX using (GTG)5 primer generated different Xcc patterns and were effective in distinguishing strains from different plant hosts.

First Report of a New Disease of Onion in Georgia Caused by a Nonfluorescent Pseudomonas Species

Since 2007, a new disease of onion (Allium cepa) called yellow bud has been a problem in Georgia. Emerging leaves display intense chlorosis and older leaves exhibit extensive leaf blight. Yield reductions can be severe due to stand loss and reduced bulb size. Symptomatic plants are also more prone to freeze damage. The suspected causal agent is a slow-growing, white bacterium isolated onto nutrient agar (NA) by streak isolation. The bacterium grew more vigorously on NA supplemented with 0.5% yeast extract (NA+). Six strains of the bacterium all had gram-negative, rod-shaped cells and were strict aerobes. The strains produced levan, were negative for oxidase, potato rot, and arginine dihydrolase, and produced a hypersensitive reaction in tobacco. These are all characteristics of Pseudomonas group Ia as outlined by Lelliott et al. (2) and differ from characteristics of known Pseudomonas pathogens of onion such as P. aeruginosa, P. marginalis, and P. viridiflava that belong to groups Va, IVa, and II, respectively. The yellow bud bacterial strains were also nonfluorescent on King's medium B and were ice nucleation active. Universal primers PA16SF and PA16SR (ATCCTGGCTCAGATTGAACG and TTCCCCTACGGTTACCTTGTT) were used to amplify the 16S rRNA gene. The resulting consensus nucleotide sequence (GenBank Accession No. JF939841) of the six isolates matched those strains of P. syringae pv. atropurpurea, P. syringae pv. maculicola, P. syringae pv. porri, and P. amygdali (96 to 98% similarity). Primers 1 and 2 (GGCGCTCCCTCGCACTT and GGTATTGGCGGGGGTGC) were used to amplify the coronafacate ligase (cfl) gene. The resulting consensus nucleotide sequence for the six isolates (GenBank Accession No. JF939842) matched the cfl gene from P. syringae pv. tomato, P. syringae pv. morsprunorum, P. syrinage pv. aesculi, and P. syringae pv. glycinea (97 to 99% similarity). Representative strains had 0.95 to 0.99% similarity to P. syringae pv. coronafaciens using Biolog (Biolog, Hayward, CA), and 0.72 to 0.96% similarity to P. syringaepv. tomato using fatty acid analysis (MIDI Inc., Newark, DE). For each of eight representative yellow bud strains, 10 greenhouse-grown onion seedlings of cv. Pegasus were inoculated on one leaf. Bacteria grown on NA+ were suspended in sterile tap water and adjusted to ~1 × 108 CFU/ml. With a hypodermic syringe and needle, 1.0 ml of inoculum was injected in to the hollow cavity of an emerging onion leaf. Chlorosis developed on inoculated leaves in 5 days and was identical to that observed with natural infections. All inoculated plants died within 14 days, confirming pathogenicity. Bacteria with characteristics described above were reisolated from symptomatic leaves. Ten control plants inoculated with sterile water remained asymptomatic. Based on the methods listed above, the yellow bud bacterium was identified as P. syringae, but pathovar designation or genomospecies (1) could not be determined because results varied among the different methods tested. The disease has been spreading throughout the Vidalia onion-growing region since it was first observed. There is significant potential for the disease to become more widespread since it also has been observed in direct-seeded, onion transplant beds. References: (1) J. P. Euzéby. List of Prokaryotic Names with Standing in Nomenclature-Genus Pseudomonas. Online publication. Retrieved from http://www.bacterio.cict.fr/p/pseudomonas.html , 2010. (2) R. A. Lelliott et al. J. Appl. Bact. 29:470, 1966.