Presence of Shiga Toxin–Producing Escherichia coli, Enteroinvasive E. coli, Enteropathogenic E. coli, and Enterotoxigenic E. coli on Tomatoes from Public Markets in Mexico

Diarrheagenic Escherichia coli pathotypes (DEP) are important foodborne pathogens in various countries, including Mexico. However, no data exist on the presence of DEP on fresh tomatoes (Solanum lycopericum) from Mexico. The frequency of fecal coliforms (FC), E. coli, and DEP were determined for two tomato varieties. One hundred samples of a saladette tomato variety and 100 samples of a red round tomato variety were collected from public markets in Pachuca, Mexico. Each tomato sample consisted of four whole tomatoes. For the 100 saladette samples, coliform bacterial, FC, E. coli, and DEP were identified in 100, 70, 60, and 10% of samples, respectively. For the 100 red round samples, coliform bacterial, FC, E. coli, and DEP were identified in 100, 75, 65, and 11% of samples, respectively. Identified DEP included Shiga toxin–producing E. coli (STEC), enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), and enterotoxigenic E. coli (ETEC). STEC were isolated from 6% of saladette samples and 5% of red round samples. ETEC were isolated from 3% of saladette samples and 4% of red round samples. EPEC were isolated from 2% of saladette samples and 3% of red round samples, and EIEC were isolated from 1% of saladette samples. Both STEC and ETEC were identified in two saladette samples and 1 red round sample. E. coli O157:H7 was not detected in any STEC-positive samples.

First Report of Southern tomato virus on Tomatoes in Southwest France

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5′ CTGGAGATGAAGTGCTCGAAGA 3′ and STV-rev 5′ TGGCTCGTCTCGCATCCTTCG 3′) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

Recovery of Salmonella from Internally and Externally Contaminated Whole Tomatoes Using Several Different Sample Preparation Procedures

Studies were conducted to determine the relative effectiveness of whole soak [current Bacteriological Analytical Manual-(BAM) Salmonella method], quarter, stomach, and blend methods for the recovery of Salmonella organisms from internally and externally contaminated tomatoes. Tomatoes were subjected to three inoculation methods: surface inoculation, internal inoculation by injection, and immersion with single Salmonella serovars. The inoculation levels ranged from 1 to 100 CFU/tomato for surface and injection inoculation or 1 to 100 CFU/mL for immersion inoculation. Tomatoes were held for 3 days after inoculation at 2–6°C prior to initiation of analysis. Contaminated tomatoes were soaked, quartered, stomached, and blended in appropriate portions of Universal Pre-enrichment broth, and incubated for 24 h at 35 ± 2°C. The BAM Salmonella culture method was followed thereafter, and tomatoes were treated as a low-microbial-load food. The stomaching procedure was significantly (P< 0.05) more effective than the whole soak procedure for recovery of internalized Salmonella from tomatoes (by injection). The blending procedure was arithmetically superior to the stomaching procedure for detection of internalized Salmonella from tomatoes (by immersion). The blending procedure showed the same effectiveness as the whole soak procedure for the detection of Salmonella on tomato surfaces. Comparisons between test portion-to-broth ratios (weight to volume) showed that a 1:3 test portion-to-broth ratio had a better buffering capacity for blended tomatoes than a 1:1 test portion-to-broth ratio. It is recommended that the current whole soak BAM tomato sample preparation procedure be replaced with a blending procedure and a 1:3 test portion-to-broth ratio.

Investigations on the Frequency of Norovirus Contamination of Ready-to-Eat Food Items in Istanbul, Turkey, by Using Real-Time Reverse Transcription PCR

Investigation of norovirus (NoV) contamination of food items is important because many outbreaks occur after consumption of contaminated shellfish, vegetables, fruits, and water. The frequency of NoV contamination in food items has not previously been investigated in Turkey. The aim of this study was to investigate the frequency of human NoV genogroups (G) I and II in ready-to-eat tomatoes, parsley, green onion, lettuce, mixed salads, and cracked wheat balls. RNA was extracted with the RNeasy Mini Kit, and a real-time reverse transcription (RT) PCR assay was performed using primers specific for NoV GI and GII. Among the 525 samples analyzed, NoV GII was detected in 1 green onion sample and 1 tomato sample by both SYBR Green and TaqMan real-time RT-PCR assays; no GI virus was detected. The Enterobactericaeae and Escherichia coli levels in the NoV-positive green onion were 6.56 and 1.28 log CFU/g, and those in the tomato were 5.55 and 1.30 log CFU/g, respectively. No significant difference in the bacterial levels was found between the NoV-positive and NoV-negative samples. This study is the first in which NoV GII was found in ready-to-eat food collected from Istanbul, Turkey; thus, these foods may be considered a risk to human health. Epidemiological studies and measures to prevent NoV infection should be considered.

An Approach to the Application of Microwave-Assisted Micellar Extraction and Liquid Chromatography with Ultraviolet Detection to the Extraction and Determination of Organophosphorus Pesticides in Tomato Samples

Microwave-assisted micellar extraction methodology was applied to extract a mixture of 8 organophosphorus pesticides from the cuticle of tomato samples prior to analysis by liquid chromatography with ultraviolet detection. This technique provided very good results and was simple, fast, and environmentally friendly. The pesticides under study were extracted using the nonionic surfactants polyoxyethylene 10 lauryl ether (POLE) and oligoethylene glycol monoalkyl ether (Genapol X-080). The optimal extraction variables to be applied were determined for each surfactant and then compared. POLE proved to be the most suitable for the extraction, with recoveries over 70% in the majority and relative standard deviation values under 4.8%. After validation using a tomato sample enriched with a certified mixture, the proposed method was applied to the analysis of organophosphorus pesticides in lettuce and pepper samples.