body width
Recently Published Documents


TOTAL DOCUMENTS

147
(FIVE YEARS 19)

H-INDEX

17
(FIVE YEARS 0)

2022 ◽  
Vol 10 (1) ◽  
pp. 43-64
Author(s):  
Marc J. P. Gouw ◽  
Marc P. Hijma

Abstract. Despite extensive research on alluvial architecture, there is still a pressing need for data from modern fluvio-deltaic environments. Previous research in the fluvial-dominated proximal and central Rhine–Meuse delta (the Netherlands) has yielded clear spatial trends in alluvial architecture. In this paper, we include the backwater length to establish architectural trends from apex to shoreline. Channel-belt sand body width / thickness ratios and interconnectedness were determined, and the proportions of fluvial channel-belt deposits, fluvial overbank deposits, organics and intertidal deposits were calculated for the complete fluvio-deltaic wedge based on high-resolution geological cross sections. It was found that the average width / thickness ratio of channel-belt sand bodies in the proximal delta is 5 times higher than in the distal delta. Other down-valley trends include an 80 % decrease in the channel deposit proportion (CDP) and a near-constant proportion of overbank deposits. Additionally, interconnectedness in the proximal delta is 3 times higher than in the distal delta. Based on the Rhine–Meuse dataset, we propose a linear empirical function to model the spatial variability of CDP. It is argued that this relationship is driven by four key factors: channel lateral-migration rate, channel-belt longevity, creation of accommodation space and inherited floodplain width. Additionally, it is established that the sensitivity of CDP to changes in the ratio between channel-belt sand body width and floodplain width (normalized channel-belt sand body width) varies spatially and is greatest in the central and distal delta. Furthermore, the proportion of fluvial channel-belt sands is generally an appropriate proxy for the total sand content of fluvio-deltaic successions, although its suitability as a total sand indicator rapidly fades in the distal delta. Characteristics of the backwater zone of the Rhine–Meuse delta are (1) sand body width / thickness ratios that are lower as a consequence of channel narrowing (not deepening), (2) a rapid increase and then a drop in the organic proportion, (3) an increase in the total sand proportion towards the shoreline, and (4) a drop in the connectedness ratio. For this paper, unique high-resolution quantitative data and spatial trends of the alluvial architecture are presented for an entire delta, providing data that can be used to further improve existing fluvial stratigraphy models.


Plant Disease ◽  
2021 ◽  
Author(s):  
Chaorong Wu ◽  
Hailian Zhou ◽  
Luming Jia ◽  
Bochang Chen ◽  
H.Y. Wu

Ormosia hosiei is an evergreen tree that belongs to the family of Fabaceae. It is prized for ornamental and medicinal value and rosewood. In November 2020, galls were observed on roots of stunted O.hosiei plants in the Nanning arboretum (22°43′38″ N, 108°18′06″ E), Guangxi, China. Disease incidence was approximately 80% (150 plants evaluated). Females were obtained by dissecting galls and J2s were collected from a single egg mass hatching. The female white body was pear to globular-shaped with a distinct neck region, while the perineal pattern usually was oval-shaped with a moderately high dorsal arch. J2 bodies were translucent with narrow tails and pointed tips, with hyaline tail termini. Those morphological characters were consistent with description of Meloidogyne enterolobii (Yang and Eisenback 1983; Brito et al. 2004). Morphological measurements (mean, standard deviation and range) of J2s (n = 20) included body length= 436.07 ± 12.5 (411.8 to 464.3) µm, body width = 16.01 ± 1.1 (14.6 to 17.7) µm, stylet length = 12.4 ± 0.8 (11.3 to 13.5) µm, dorsal esophageal gland orifice to the stylet base (DGO) = 3.8 ± 0.3 (3.3 to 4.3) µm, tail = 53.6 ± 4.3 (48.9 to 60.6) µm, and hyaline tail length = 15.9 ± 1.5 (13.6 to 18.3) µm. Measurements of females (n = 20) were: body length = 669.5 ± 43.8 (549.9 to 709.4) μm, body width = 641.9 ± 45.2 (559.3 to 732.8) μm, DGO = 5.3 ± 0.52 (4.6 to 6.1) μm, and stylet length = 14.9 ± 0.86 (13.8 to 16.8) μm. These measurements were also consistent with M. enterolobii (Yang and Eisenback. 1983). The ITS rRNA gene sequence and D2-D3 expansion segment of 28S rDNA were amplified in the DNA of individual J2 using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006 ). The sequences were submitted in the NCBI with GeneBank Accessions No. MZ617284 (766-bp) and OK072889 (759-bp). The homology of the genes was 99% to 100% identical to that of M. enterolobii in ITS rRNA gene sequence MT406251, MG773551, KF418369. The D2-D3 region of 28S rRNA gene revealed 100% identity with M. enterolobii sequences from MT193450, MF467276, MZ541997 etc. Neighbor-joining phylogenetic analysis showed that it was the most similar to M. enterolobii. For further confirmation, M. enterolobii species-specific primer pairs Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the ribosomal intergenic spacer 2. An expected PCR fragment of approximately 236-bp was obtained (Long et al. 2006). Pathogenicity test was conducted in greenhouse with 26 to 30˚C temperature. Eggs were multiplied in the greenhouse using a single eggmass hand-picked from infested O. hosiei roots. Twelve eight-month-old O. hosiei healthy seedlings were inoculated with 5,000 eggs/pot containing autoclaved soil mix (clay: substrate =1:3, v/v), and 6 noninoculated seedlings were controls. After 10 weeks, the control plants displayed no symptoms. The roots of all inoculated plants showed galling symptoms. The reproduction factor (final population/initial population) was 5.2. Furthermore, the morphological and molecular identification of the nematode was identical to the original samples. M. enterolobii has a broad host range (Philbrick et al. 2020). To our knowledge, this is the first report of M. enterolobii parasitizing O. hosiei worldwide. This finding expands the host range of this nematode.


2021 ◽  
Vol 12 (4) ◽  
pp. 642-648
Author(s):  
D. Kryvoruchenko ◽  
Y. Prykhodko ◽  
O. Mazannyі ◽  
O. Titarenko ◽  
I. Reva ◽  
...  

Heartworm disease is a widespread anthropozoonotic disease of carnivorous animals, as well as humans. It is caused by nematodes belonging to the suborder Filariata, family Onchocercidae, genus Dirofilaria. There are about 26 species of heartworms in nature, the most common and pathogenic species in dogs and cats in most countries is Dirofilaria immitis Leidy, 1856. Mature helminths parasitize in the right ventricle and pulmonary arteries, large veins of animals and cause heart and vascular disorders, and death. Therefore, the aim of the study was to investigate the features of morphological and metric structure of adult nematodes of D. immitis isolated from the heart of dogs. Morphological studies have shown that in males the most characteristic differential features are the presence of two unequal spicules, specifically positioned relative to each other, as well as well-defined preanal and less pronounced adanal and postanal papillae. In female heartworms, the characteristic morphological features are the shape and location of the vulva. There is a difference in the structure of the esophagus in males and females. In females, the anterior and posterior parts of the esophagus are well expressed, with enlargements, in males these divisions are not pronounced. To increase the efficiency of species identification of D. immitis nematodes, it is proposed to use metric parameters that characterize the overall body size, body and width of esophagus in different areas, length of esophagus, and the location of the nerve ring. In males, 11 indicators are also suggested that characterize the size of the spicules and the location of the cloaca. In females, seven additional parameters are pointed out that characterize the location of the vulva, anus and body width in these areas. The obtained data expand the already existing data on the peculiarities of the morphological structure of parasitic nematodes of the species D. immitis and their identification.


Check List ◽  
2021 ◽  
Vol 17 (4) ◽  
pp. 1021-1029
Author(s):  
Hmar Tlawmte Lalremsanga ◽  
Jayaditya Purkayastha ◽  
Mathipi Vabeiryureilai ◽  
Lal Muansanga ◽  
Ht Decemson ◽  
...  

We report a substantial range extension of Ichthyophis multicolor Wilkinson, Presswell, Sherratt, Papadopoulou & Gower, 2014, with new material from Mizoram State, Northeast India. The species was previously known only from its type locality more than 800 km away in Ayeyarwady Region, Myanmar. The species was identified by both its morphology and 16s rRNA gene sequence data. One of the studied individuals represents the largest known specimen for the species (total length = 501 mm; mid-body width = 18.8 mm). Brief comparisons of I. multicolor with the sympatric as well as parapatric congeners in the region, and first barcode data for I. moustakius Kamei, Wilkinson, Gower & Biju, 2009 are also presented.


Plant Disease ◽  
2021 ◽  
Author(s):  
Hamzeh Lafi ◽  
Fahad Al-Yahya ◽  
Ahmad Al Hazmi

The genus Morus comprises many species (Suttie 2012). The species Morus alba is one of the most popular mulberry species worldwide. In October 2020, numerous mulberry trees presented chlorotic leaves and stunted growth with severe root galling in a private compound in Riyadh region, Saudi Arabia. The infected roots showed galls, which are typical symptoms of infection by root-knot nematodes (RKNs). Infected roots were dissected, and males and females were extracted from roots while second stage juveniles (J2s) were from both soil and eggmasses. Morphological and morphometrical features were documented. Perineal patterns of females, males, and J2s were studied using a compound microscope. The endoparasitic females had pearly shaped bodies with projecting neck. Stylet knobs were rounded and set off and the shape of the cone distinctly curved. The posterior perineal had a dorsally high square arch. Striae patterns were zig-zag or forked along the lateral lines. Males were vermiform and the head cap flat to concave. Mostly conus of stylet was longer than shaft. Stylet knobs were prominent, set off, flat and usually greater width than the length. Males had a bluntly rounded tail, spicules were slightly curved and gubernaculum was crescentic. The J2s were vermiform, and stylet knobs were prominent and rounded shape. The J2s tail had a transparent area with an obtuse tip. The morphological measurements (means and range) of the perineal patterns of females (n = 4) were: length of vulval slit (LVS) = 22.5 (21.5 to 23.4) μm, anus to vulval slit (AVS) = 22 (21.8 to 22.1) μm, and anus length (AL) = 7.7 (7.5 to 7.8) μm. The males (n = 16) measurements were: length (L) = 1136 (1116 to 1159) μm; a (total body length / greatest body width) = 34.8 (33 to 37.1); body width = 32.7 (31.2 to 33.8) μm; stylet length = 25.6 (24.7 to 27.3) μm; dorsal oesophageal gland orifice (DGO) = 2.9 (2.6 to 3) μm, tail length = 7.1 (6.5 to 7.8) μm, c (total body length / tail length) = 161 (143.1 to 175), spicules length = 30.8 (26 to 33.8) μm; gubernaculum = 9.7 (9.1 to 10.4) μm. The J2s (n = 11) measurements were: L = 395 (378 to 405) μm; a = 26.2 (24.3 to 28.4); c = 8.6 (8.2 to 9.2); head end to metacorpus valve = 53 (49.4 to 54.6) μm; excretory pore to head end = 78 (72.8 to 80) μm, stylet length = 10.7 (10.4 to 11.7) μm; body width = 15.1 (14.3 to 15.6) μm; tail length = 45.8 (44.2 to 49.4) μm; hyaline tail terminus length = 12.5 (10.4 to 13) μm. Both the morphological and morphometrical features of the perineal pattern of the females, males, and J2s match the original description of Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Eisenback and Hirschmann 1981; Taylor and Netscher 1974). To perform Koch’s postulates, mulberry plants maintained in pots were inoculated with 2,500 J2s and eggs of the original population of M. incognita using five replicates. After two months, all inoculated plants had galled roots typical of RKNs. Reproduction factor value was 6.4. The noninoculated plants did not present galls in the roots. These results confirmed the nematode’s pathogenicity on mulberry. To the best of our knowledge, this is the first report that M. incognita was identified as a parasite of mulberry (Morus alba) in Saudi Arabia and the world, while Meloidogyne hispanica was reported on mulberry trees in Iran (Shokoohi et al. 2016). The importance of this report shed some lights on this new problem to direct the attention of farmers and home gardeners to take actions for the management of this newly identified problem. The authors declare no conflict of interest. Acknowledgments Authors wish to thanks College of Food and Agricultural Sciences, Research Center and Deanship of Scientific Research, King Saud University, Saudi Arabia for supporting this work. References: Eisenback, J. D. and Hirschmann, H. 1981. J. Nematol. 13:513. Shokoohi, E. et al. 2016. Australasian Plant Dis. Notes 11:16. Suttie, J. M. 2012. Food and Agricultural Organization of the United Nations. Taylor D. P., Netscher, C. 1974. Nematologica 20:268.


Perception ◽  
2021 ◽  
pp. 030100662110253
Author(s):  
Anabela Nicula ◽  
Matthew R. Longo

The perceived distance between two touches is anisotropic on many parts of the body. Generally, tactile distances oriented across body width are perceived as larger than distances oriented along body length, though the magnitude of such biases differs substantially across the body. In this study, we investigated tactile distance perception on the back. Participants made verbal estimates of the perceived distance between pairs of touches oriented either across body width or along body length on (a) the left hand, (b) the left upper back, and (c) the left lower back. There were clear tactile distance anisotropies on the hand and upper back, with distances oriented across body width overestimated relative to those along body length/height, consistent with previous results. On the lower back, however, an anisotropy in exactly the opposite direction was found. These results provide further evidence that tactile distance anisotropies vary systematically across the body and suggest that the spatial representation of touch on the lower back may differ qualitatively from that on other regions of the body.


Zootaxa ◽  
2021 ◽  
Vol 4985 (2) ◽  
Author(s):  
TAM T.T. VU

Truxonchus quangi sp. n. is described and illustrated from Vietnam. Females of the new species are characterized by large body size (L = 4.8-5.8 mm); barrel shaped buccal cavity of large size (105-113 x 66-73 µm) with one dorsal tooth and two subventral teeth posteriorly directed, of equal shape, size and apex position; dorsal tooth apex located 36-39% of buccal cavity length from its base; reproductive system didelphic-amphidelphic, vagina long, 39-45% of corresponding body width, with distinct par refringens vaginae, sclerotized pieces rounded in optical section; tail long, filiform, ventrally arcuate, with three small caudal glands in tandem and prominent subventral spinneret. The new species is close to T. dolichurus but differs by the larger buccal cavity, more anterior position of the dorsal tooth apex, more anterior vulval position and presence of advulval pores.


2021 ◽  
Author(s):  
Marc J. P. Gouw ◽  
Marc P. Hijma

Abstract. Despite extensive research on alluvial architecture, there is still a pressing need for data from modern fluvio-deltaic environments. Previous research in the fluvial-dominated proximal and central Rhine-Meuse delta (The Netherlands) has yielded clear spatial trends in alluvial architecture. In this paper, we include the backwater length to establish architectural trends from apex to shoreline. Channel-belt sand body width/thickness ratios and interconnectedness were determined and the proportions of fluvial channel-belt deposits, fluvial overbank deposits, organics and intertidal deposits were calculated for the complete fluvio-deltaic wedge, based on high-resolution geological cross-sections. It was found that the average width/thickness ratio of channel-belt sand bodies in the proximal delta is five times higher than in the distal delta. Other down-valley trends include an 80 %-decrease of the channel deposit proportion (CDP) and a near-constant proportion of overbank deposits. Additionally, interconnectedness in the proximal delta is three times higher than in the distal delta. Based on the Rhine-Meuse dataset, the authors propose a linear empirical function to model the spatial variability of CDP. It is argued that this relationship is driven by four key factors that change along stream: channel lateral-migration rate, channel-belt longevity, creation of accommodation space and inherited flood-plain width. Additionally, it is established that the sensitivity of CDP to changes in the ratio between channel-belt sand body width and flood-plain with, (normalised channel-belt sand body width) varies spatially and is greatest in the central and distal delta. Also, the proportion of fluvial channel-belt sands is generally an appropriate proxy for the total sand content of fluvio-deltaic successions, albeit that its suitability as a total-sand indicator rapidly fades in the distal delta. With this paper, unique high-resolution quantitative data and spatial trends on the alluvial architecture are available for an entire delta, hereby providing a dataset that can be used to further improve existing fluvial stratigraphy models.


Zootaxa ◽  
2021 ◽  
Vol 4980 (1) ◽  
pp. 45-63
Author(s):  
MARCELO KOVAČIĆ ◽  
HAMID REZA ESMAEILI ◽  
FATAH ZAREI ◽  
KEYVAN ABBASI ◽  
ULRICH K. SCHLIEWEN

A new gobiid species, Benthophilus persicus sp. nov., is described from the southern Caspian Sea, Iran. The new species is diagnosed by the following character states: dermal fold on cheek well-developed, large, rectangular; chin barbel 1/3–2/3 of eye diameter; maximum body width 15.1–22.9% of standard length; mouth width, 36.3–55.8% of head length; second dorsal fin I+7–8; origin of anal fin in front of vertical through origin of second dorsal fin; dermal tubercles present on body, clearly larger than granules, with two posterior rows of spinules forming an acute angle, always less than right angle; dorsal row of tubercles complete, 22–29; ventral row of tubercles 22–25; ventrolateral row of tubercles absent; tubercles not present on temporal and occipital head regions; granules not present on flanks; transversal suborbital row 6i below posterior end of row b; anterior interorbital transversal row pa with one or two papillae and anterior interorbital transversal papilla row pp with two or three papillae; body with 20–22 transversal ltm rows starting anteriorly behind pectoral axilla and alternating anteriorly with three longitudinal llm rows. 


bionature ◽  
2021 ◽  
Vol 22 (1) ◽  
Author(s):  
Pariyanto Pariyanto ◽  
Apriza Fitriani ◽  
Panji Prasatyo

Abstract. This study aims to determine the diversity and characteristics of freshwater fish in Sungai lais, lais sub-district, Bengkulu Utara district, Bengkulu province. This research was conducted using survey methods and to obtain primary data taken into the field by direct capture. Samples were taken in sungai lais, lais sub-district, Bengkulu Utara regency is done by dividing 3 stations. Measurement of fish morphometric characteristics is done by measuring fish body parts including, total length (PT), standard length (PB), head length (PK), height (TB), body width (LB) and tail height (TE). The results showed that the diversity index which is found in the lais river which is classified as low, with a diversity index at station A 0.666, station B 0.724 and station C 0.522. The types of fish found in this study consisted of 8 species namely Cyprinus carpio (goldfish), Osteohilus vittatus (palau fish), Anabas testudienus (fish betok), Channa striata (cork fish), Oreochromis niloticus (tilapia), Oreochromis mossambicus (tilapia fish), Trighogaster trichopterus (sepat fish), and Clarias batrachus (catfish).Keywords: Diversity, Fish, Lais River, Morphometric Characteristic


Sign in / Sign up

Export Citation Format

Share Document