First report of Grapevine enamovirus 1 in Vitis vinifera cultivar ‘Meunier’ in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera ‘Meunier’ leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5’ untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3’-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected ‘Meunier’ grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the ‘Meunier’ grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original ‘Meunier’ plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5’ untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3’-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected ‘Meunier’ grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the ‘aphid transmission protein’ producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original ‘Meunier’ plant from Champagne was found positive for GEV-1 in gapevine in France.

Sampling for vegetative propagation: A phytosanitary status survey of grapevines collection by One Step RT-PCR method

Purpose. Grapevines (Vitis spp.) are affected by many viral diseases which cause serious pathological problems. GLRaV-3 is among the most widespread leafroll viruses, while Grapevine Fanleaf Virus (GFLV) is a destructive pathogen which reduces the lifespan of grapevine. Considering the impact and the spread of these diseases, our objective was to analyse the presence of these two viruses in several grapevine varieties in grapevine collection at ATTC Vlore. Data gathered from plant pathogens serve to better understand and prevent the spread of pathogens, as a mandatory rule for the quality control of certified plant material during vegetative propagation. Method. The presence of two common viruses were tested using virus specific primers; LC1/LC2 primer pair designed from the hHSP70 gene for detecting Grapevine Leafroll-associated Virus-3 (GLRaV3) and C3390/H2999 primer pair, designed from coat protein coding regions for detecting Grapevine Fanleaf Virus (GFLV), in six varieties; ‘Merlot’, ‘Kallmet’, ‘Shesh i zi’, ‘Shesh i bardhё’, ‘Debinё’, and ‘Pulёz’, provided through a randomised sampling procedure. One Step Reverse Transcription Polymerase Chain Reaction assay was used to detect the viral presence. Results showed a high (100%) prevalence of GLRaV3 virus in all of analysed samples, as the most frequent among the two pathogens. Analysis for of GFLV virus showed low infection rate, being present in only one sample. Conclusions. We herein show an efficient, fast and reproducible method for detecting grapevine viruses through one step RT-PCR. Our results suggest that sampling of the infected plant material should be avoided due to the presence of viral infections.

Selected genotypes with the genetic background of Vitis aestivalis and Vitis labrusca are resistant to Xiphinema index

The ectoparasitic nematode Xiphinema index transmits grapevine fanleaf virus (GFLV) during feeding on grapevine roots, causing fanleaf degeneration in the plant. Hence, resistance breeding is a key to develop novel rootstocks to overcome such threats. In the past years, various grapevine species were screened, and a few candidates with partial resistance were identified. Yet, they were hardly sufficient for viticulture due to many agronomical defects. To develop reliably resistant rootstocks applicable in viticulture, multiple Vitis spp. genotypes were analyzed using root inoculation with nematodes in glass vials as an early and easy evaluation test. Resistance levels were evaluated 35 days after inoculation based on nematode reproduction factors focusing on juveniles and eggs. Infection of grapevines with GFLV was analyzed after inoculation with viruliferous X. index. With this fast screening system, putative candidates with resistances against X. index have been identified for future breeding programs. Particularly, genotypes with the genetic background of V. aestivalis and V. labrusca were found to be nematode resistant.

A single resistance factor to solve vineyard degeneration due to grapevine fanleaf virus

Grapevine fanleaf disease, caused by grapevine fanleaf virus (GFLV), transmitted by the soil-borne nematode Xiphinema index, provokes severe symptoms and economic losses, threatening vineyards worldwide. As no effective solution exists so far to control grapevine fanleaf disease in an environmentally friendly way, we investigated the presence of resistance to GFLV in grapevine genetic resources. We discovered that the Riesling variety displays resistance to GFLV, although it is susceptible to X. index. This resistance is determined by a single recessive factor located on grapevine chromosome 1, which we have named rgflv1. The discovery of rgflv1 paves the way for the first effective and environmentally friendly solution to control grapevine fanleaf disease through the development of new GFLV-resistant grapevine rootstocks, which was hitherto an unthinkable prospect. Moreover, rgflv1 is putatively distinct from the virus susceptibility factors already described in plants.

Genetic Structure and Molecular Variability of Grapevine Fanleaf Virus in Sicily

Grapevine fanleaf virus (GFLV) is one of the main causes of grapevine fanleaf degeneration disease (GFDD) and is present in almost all areas where grapevine is cultivated. In this work, we ascertained the presence and spread of GFLV in different commercial vineyards in four Sicilian provinces (Italy), and its genetic structure and molecular variability were studied. In detail, a total of 617 grapevine samples of 11 autochthonous grapevine cultivars were collected in 20 commercial vineyards. Preliminary screening by serological (DAS-ELISA) and molecular (RT-PCR) analyses for ArMV (arabis mosaic virus) and GFLV detection were conducted. Results obtained showed the absence of ArMV in all the samples analyzed, while 48 out of 617 samples gave positive results to GFLV, for a total of 9 out of 11 cultivars analyzed. Phylogenetic analyses carried out on the GFLV-CP gene of 18 Sicilian GFLV sequences selected in this study showed a certain degree of variability among the Sicilian isolates, suggesting a different origin, probably as a consequence of the continuous interchange of GFLV-infected propagating material with other Italian regions or viticultural areas located in other countries.

Identification of protein interactions of grapevine fanleaf virus RNA-dependent RNA polymerase during infection of Nicotiana benthamiana by affinity purification and tandem mass spectrometry

The RNA-dependent RNA polymerase (1EPol) is involved in replication of grapevine fanleaf virus (GFLV, Nepovirus, Secoviridae) and causes vein clearing symptoms in Nicotiana benthamiana. Information on protein 1EPol interaction with other viral and host proteins is scarce. To study protein 1EPol biology, three GFLV infectious clones, i.e. GHu (a symptomatic wild-type strain), GHu-1EK802G (an asymptomatic GHu mutant) and F13 (an asymptomatic wild-type strain), were engineered with protein 1EPol fused to a V5 epitope tag at the C-terminus. Following Agrobacterium tumefaciens -mediated delivery of GFLV clones in N. benthamiana and protein extraction at seven dpi, when optimal 1EPol:V5 accumulation was detected, two viral and six plant putative interaction partners of V5-tagged protein 1EPol were identified for the three GFLV clones by affinity purification and tandem mass spectrometry. This study provides insights into the protein interactome of 1EPol during GFLV systemic infection in N. benthamiana and lays the foundation for validation work.

Grapevine Pinot gris virus infecting grapevines in Romania - Short Communicaiton

Grapevine Pinot gris virus (GPGV) has been identified in many grape growing countries of the world since 2012. The aim of this work was to investigate the presence of GPGV on some accessions collected from a germplasm collection, in addition to the propagation material and clonal selection samples. During 2019–2020, a total of 199 samples have been analysed by a double antibody sandwich – enzyme-linked immunosorbent assay (DAS-ELISA) for the presence of GPGV, Grapevine fanleaf virus (GFLV), Grapevine leafroll-associated virus-1+3 (GLRaV-1+3) and Grapevine fleck virus (GFkV). Among them, 107 samples (53.76%) showed a GPGV-infection, associated with or without symptoms on the leaves (deformations, chlorosis, mosaic, wrinkles) or stunting plants. The distribution of infected varieties showed a high rate of infection in old varieties (37.38%), followed by clones (32.71%), rootstocks (11.21%), clonal selections (9.35%) and new varieties (9.35%). The tests revealed the association of GPGV with GFkV (5 cases) and GLRaV-1+3 (2 cases). GPGV should be included in the rules of grapevine certification schemes for the production of virus-free mother plants.

Studies on the Occurrence of Viruses in Planting Material of Grapevines in Southwestern Germany

Viral diseases in viticulture lead to annual losses in the quantity and quality of grape production. Since no direct control measures are available in practice, preventive measures are taken to keep the vines healthy. These include, for example, the testing of propagation material for viruses such as Arabis mosaic virus (ArMV), Grapevine fanleaf virus (GFLV) or Grapevine leafroll-associated virus 1 (GLRaV-1) and 3 (GLRaV-3). As long-term investigations have shown, GLRaV-1 (2.1%) occurs most frequently in southwestern German wine-growing regions, whereas GLRaV-3 (<0.1%) is almost never found. However, tests conducted over 12 years indicate that there is no general decline in virus-infected planting material. Thus, it can be assumed that a spread of the viruses via corresponding vectors still takes place unhindered. Beyond the examinations regulated within the German Wine Growing Ordinance, one-time tests were carried out on Grapevine Pinot gris virus (GPGV). This analysis showed that GPGV was found in 17.2% of the samples.

Survey of five major grapevine viruses infecting Blatina and Žilavka cultivars in Bosnia and Herzegovina

The sanitary status of grapevines has not yet been considered sufficiently in vineyards throughout Bosnia and Herzegovina (BiH). An extensive survey of five major grapevine viruses in the country was carried out in 2019. A total of 630 samples from the two dominant autochthonous cultivars, named Žilavka and Blatina, were tested by DAS-ELISA for the presence of grapevine leafroll-associated viruses (GLRaV-1 and 3), grapevine fleck virus (GFkV), grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV). Eighty-eight % of the samples were positive for at least one virus, and all five viruses were detected, thought with different incidence, i.e. GLRaV-3 (84%), GFLV (43%), GLRaV-1 (14%), GFkV (10%) and ArMV (0.2%). The majority of infected plants (about 75%) were asymptomatic. Specific virus symptoms were observed in the remaining infected plants, together with the reported GLRaV vectors, Planococcus ficus and Parthenolecanium corni, while nematodes of the Xiphinema genus were not found in the GFLV- or ArMV-infected vineyards. The GLRaV-3 CP phylogenetic analyses showed 75–100% nucleotide identity between the BiH and reference isolates, and the BiH isolates clustered into the major group. The dNS/dS ratio indicated a negative selection of the virus population, and the lack of geographical structuring within the population was observed. In addition, putative GLRaV-3 recombinants with breakpoints in the 5’ of the CP gene were detected, while no recombinant strains were identified for the other four viruses. The obtained results indicate a deteriorated sanitary status of the cultivated grapevines, the prevalence and intraspecies genetic diversity of GLRaV-3 throughout the country. The establishment of certified grapevine material and adequate virus vector control is therefore of primary importance to prevent further spread of these viruses. This study presents the results of the first molecular characterisation of grapevine viruses in Bosnia and Herzegovina.