The Painted Leafhopper, Endria inimica (Say), a Vector of Wheat Striate Mosaic Virus in Manitoba

1966 ◽  
Vol 98 (9) ◽  
pp. 922-931 ◽  
Author(s):  
P. H. Westdal ◽  
H. P. Richardson
Keyword(s):  
Life Cycle ◽  
North America ◽  
Mosaic Virus ◽  
Lower Limit ◽  
Virus Transmission ◽  
Low Frequency ◽  
High Rate ◽  
Life Stages ◽  
Rate Of Development ◽  
Two Generations

AbstractThe painted leafhopper, Endria inimica (Say), occurs in grasslands in southern Canada and the northern states of the U.S.A. It is the only known vector of wheat striate mosaic virus (WSMV) in North America. In Manitoba the insect is not abundant. It does not migrate into the province, and overwinters in the egg stage only. There are two generations per year, the first completing development on grasses about 1 July and the second developing mainly on cereals in summer. E. inimica has a high rate of development at 90° F.; the lower limit is near 60° F. At 80 ± 5° F. the life cycle was completed in 45.8 days. In the field, in summer, the life cycle was completed in 42 days. A description of the life stages of the insect is presented.WSMV has occurred only in trace amounts in Manitoba. Leafhoppers collected in the field showed a low frequency of virus transmission and the source of overwintered virus appeared to be small. The disease does not appear to constitute a serious problem in Manitoba.

scholarly journals Simulation of leaf curl disease dynamics in chili for strategic management options

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Buddhadeb Roy ◽  
Shailja Dubey ◽  
Amalendu Ghosh ◽  
Shalu Misra Shukla ◽  
Bikash Mandal ◽  
...  
Keyword(s):  
Disease Risk ◽  
Virus Transmission ◽  
Host Population ◽  
High Rate ◽  
Disease Dynamics ◽  
Model Framework ◽  
Management Options ◽  
Transmission Parameters ◽  
Vector Population ◽  
Leaf Curl

AbstractLeaf curl, a whitefly-borne begomovirus disease, is the cause of frequent epidemic in chili. In the present study, transmission parameters involved in tripartite interaction are estimated to simulate disease dynamics in a population dynamics model framework. Epidemic is characterized by a rapid conversion rate of healthy host population into infectious type. Infection rate as basic reproduction number, R0 = 13.54, has indicated a high rate of virus transmission. Equilibrium population of infectious host and viruliferous vector are observed to be sensitive to the immigration parameter. A small increase in immigration rate of viruliferous vector increased the population of both infectious host and viruliferous vector. Migrant viruliferous vectors, acquisition, and transmission rates as major parameters in the model indicate leaf curl epidemic is predominantly a vector -mediated process. Based on underlying principles of temperature influence on vector population abundance and transmission parameters, spatio-temporal pattern of disease risk predicted is noted to correspond with leaf curl distribution pattern in India. Temperature in the range of 15–35 °C plays an important role in epidemic as both vector population and virus transmission are influenced by temperature. Assessment of leaf curl dynamics would be a useful guide to crop planning and evolution of efficient management strategies.

THE AUTOECIOUS SPECIES OF PUCCINIA ON HELIANTHEAE IN NORTH AMERICA

1967 ◽  
Vol 45 (12) ◽  
pp. 2267-2327 ◽  
Author(s):  
J. A. Parmelee
Keyword(s):  
New Species ◽  
Life Cycle ◽  
North America ◽  
Type Material ◽  
Material Distribution ◽  
New Combinations ◽  
New Varieties

Sixty-two taxa are recognized in this study of the species of Puccinia completing their life cycle on Heliantheae. Six new species are described: Puccinia guatemalensis Parmelee on Zexmenia spp. and Wedelia spp., P. ghiesbreghtii Parmelee on Wedelia ghiesbreghtii, P. abramsii Parmelee on Geraea viscida (= Encelia viscida), P. chloracae Parmelee on Viguiera spp., P. calanticariae Parmelee on Viguiera spp., and P. praetermissa Parmelee on Lagascea spp. Six new varieties are recognized: Puccinia electrae var. robusta Parmelee and P. electrae var. depressiporosa Parmelee on Zexmenia brevifolia, P. caleae var. cuernavacae Parmelee on Calea spp., P. cognata var. echinulata Parmelee on Verbesina spp., P. cognata var. fraseri Parmelee on Viguiera fraseri, and P. affinis var. triporosa Parmelee on Viguiera spp. Three taxa have been restored from synonomy under P. abrupta, viz. P. subglobosa, P. ximenesiae, and P. affinis, the last two parasitic on Verbesina spp., the first on Rhysolepis (= Viguiera). P. tithoniae, P. nanomitra, and P. ordinata, are reduced to synonomy with P. enceliae var. enceliae, P. iostephanes, and P. melampodii respectively. New combinations include: P. enceliae var. aemulans (Syd.) Parmelee and P. abrupta var. partheniicola (Jacks.) Parmelee. A key based on uredinial and telial characters, others based initially on the hosts, and a host index are provided. Each taxon is illustrated by a photomicrograph from type material. Distribution and host extensions, supplementary to those given in Arthur's Manual of the Rusts, are indicated.

Mode Switching of the Natural Low-Frequency Oscillations of the Tobacco Mosaic Virus when the Temperature of Its Aqueous Suspension Changes

JETP Letters ◽  
2021 ◽  
Vol 113 (11) ◽  
pp. 733-737
Author(s):  
A. F. Bunkin ◽  
M. A. Davydov ◽  
A. N. Fedorov ◽  
M. V. Arkhipenko ◽  
V. B. Oshurko ◽  
...  
Keyword(s):  
Tobacco Mosaic Virus ◽  
Mosaic Virus ◽  
Aqueous Suspension ◽  
Low Frequency ◽  
Mode Switching ◽  
Low Frequency Oscillations

Chrysomyxa abietis (needle rust of fir).

2021 ◽  
Author(s):  
Keyword(s):  
Life Cycle ◽  
New Zealand ◽  
North America ◽  
Rust Fungus ◽  
Significant Problem ◽  
Northern Europe ◽  
Native Range ◽  
Obligate Parasite ◽  
The Usa ◽  
Accidental Introduction

Abstract C. abietis is a microcyclic rust fungus; an obligate parasite completing its life cycle on species of Picea (spruce). Only the current year's needles of Picea are infected and those needles are shed early. Reported from northern Europe and Asia, the fungus is a Regulated Pest for the USA. It is absent from North America, where susceptible species are native, and Australia and New Zealand, where they are introduced. Although usually not a significant problem in its native range, because conditions are not favourable for heavy infections every year (Smith et al., 1988; Hansen, 1997), this rust could be more damaging as an invasive in other temperate areas. Due to the fact that small amounts of infection may be overlooked, accidental introduction could occur through importation of infected seedlings or young trees.

Virus Vector Relationship of Yellow Mosaic Virus and Whitefly, Bemisia tabaci (Gennadius) in Soybean

2021 ◽  
Author(s):  
M. Swathi ◽  
Neeta Gaur ◽  
Kamendra Singh
Keyword(s):  
Mosaic Virus ◽  
Virus Disease ◽  
Management Strategies ◽  
Virus Transmission ◽  
Virus Vector ◽  
Yellow Mosaic Virus ◽  
Starvation Period ◽  
Mungbean Yellow Mosaic Virus ◽  
Biological Relationship ◽  
Relationship Of

Background: Whitefly is one of the most destructive sucking pest in the tropical and subtropical regions of the world and causing significant crop losses directly by sucking sap from the plants and indirectly through the transmission of viral diseases specifically caused by the genus Begomovirus. The Begomovirus species viz., Mungbean yellow mosaic India virus (MYMIV) and Mungbean yellow mosaic virus (MYMV) are causing yellow mosaic virus disease in soybean, which is transmitted by whiteflies. The disease accounts to 30-70 per cent yield loss and increases up to 80 - 100 per cent during severe incidence. Hence, there is a need for development of integrated pest management strategies against disease and whiteflies, for this the knowledge on virus-vector relationship is required. But, the studies on biological relationship of yellow mosaic virus disease and whitefly in soybean are scarce. At this juncture, considering the importance of disease in soybean, the present investigation was carried out to know the virus -vector relationship of the YMV and whitefly in soybean.Methods: The experiment on virus-vector relationship of yellow mosaic virus and whitefly in soybean was conducted at Department of Entomology, College of Agriculture, G. B. Pant University of Agriculture and Technology, Pantnagar, Uttarakhand during 2016-17. The data on number of whiteflies per plant, acquisition and inoculation access feeding period and pre and post starvation period required for effective transmission of virus was recorded.Result: A single viruliferous whitefly was able to transmit virus and ten viruliferous whiteflies per plant were required for cent per cent transmission of virus. The minimum acquisition access and inoculation access feeding periods required for virus transmission was 0.25h (15 min) each; while the 100 per cent virus transmission was recorded with acquisition and inoculation period of 12h, each. The per cent transmission was increased with the increase of acquisition and inoculation periods. The rate of transmission was positively correlated with pre-acquisition starvation period and negatively correlated with post- acquisition starvation period.

scholarly journals Dynamics of Eddy-Driven Low-Frequency Dipole Modes. Part I: A Simple Model of North Atlantic Oscillations

2007 ◽  
Vol 64 (1) ◽  
pp. 3-28 ◽  
Author(s):  
Dehai Luo ◽  
Anthony R. Lupo ◽  
Han Wan
Keyword(s):  
Life Cycle ◽  
Theoretical Model ◽  
North Atlantic ◽  
Low Frequency ◽  
Positive Phase ◽  
Negative Phase ◽  
Synoptic Scale ◽  
Planetary Scale ◽  
The North ◽  
The North Atlantic Oscillation

Abstract A simple theoretical model is proposed to clarify how synoptic-scale waves drive the life cycle of the North Atlantic Oscillation (NAO) with a period of nearly two weeks. This model is able to elucidate what determines the phase of the NAO and an analytical solution is presented to indicate a high similarity between the dynamical processes of the NAO and zonal index, which is not derived analytically in previous theoretical studies. It is suggested theoretically that the NAO is indeed a nonlinear initial-value problem, which is forced by both preexisting planetary-scale and synoptic-scale waves. The eddy forcing arising from the preexisting synoptic-scale waves is shown to be crucial for the growth and decay of the NAO, but the preexisting low-over-high (high-over-low) dipole planetary-scale wave must be required to match the preexisting positive-over-negative (negative-over-positive) dipole eddy forcing so as to excite a positive (negative) phase NAO event. The positive and negative feedbacks of the preexisting dipole eddy forcing depending upon the background westerly wind seem to dominate the life cycle of the NAO and its life period. An important finding in the theoretical model is that negative-phase NAO events could be excited repeatedly after the first event has decayed, but for the positive phase downstream isolated dipole blocks could be produced after the first event has decayed. This is supported by observed cases of the NAO events presented in this paper. In addition, a statistical study of the relationship between the phase of the NAO and blocking activity over Europe in terms of the seasonal mean NAO index shows that blocking events over Europe are more frequent and long-lived for strong positive-phase NAO years, indicating that the positive-phase NAO favors the occurrence of European blocking events.

scholarly journals First Report of Southern tomato virus on Tomatoes in Southwest France

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
T. Candresse ◽  
A. Marais ◽  
C. Faure
Keyword(s):  
North America ◽  
Seed Transmission ◽  
The United States ◽  
High Rate ◽  
Reference Sequence ◽  
Tomato Mosaic Virus ◽  
Potential Contribution ◽  
First Report ◽  
Tomato Sample ◽  
Potential Pathogenicity

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5′ CTGGAGATGAAGTGCTCGAAGA 3′ and STV-rev 5′ TGGCTCGTCTCGCATCCTTCG 3′) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

Autonomy and integration in complex parasite life cycles

Parasitology ◽  
2016 ◽  
Vol 143 (14) ◽  
pp. 1824-1846 ◽  
Author(s):  
DANIEL P. BENESH
Keyword(s):  
Life Cycle ◽  
Holistic Approach ◽  
Life Cycles ◽  
Complex Life Cycle ◽  
Functional Specialization ◽  
Life Stages ◽  
Free Living ◽  
New Host ◽  
Complex Life Cycles ◽  
Life Cycle Stages

SUMMARYComplex life cycles are common in free-living and parasitic organisms alike. The adaptive decoupling hypothesis postulates that separate life cycle stages have a degree of developmental and genetic autonomy, allowing them to be independently optimized for dissimilar, competing tasks. That is, complex life cycles evolved to facilitate functional specialization. Here, I review the connections between the different stages in parasite life cycles. I first examine evolutionary connections between life stages, such as the genetic coupling of parasite performance in consecutive hosts, the interspecific correlations between traits expressed in different hosts, and the developmental and functional obstacles to stage loss. Then, I evaluate how environmental factors link life stages through carryover effects, where stressful larval conditions impact parasites even after transmission to a new host. There is evidence for both autonomy and integration across stages, so the relevant question becomes how integrated are parasite life cycles and through what mechanisms? By highlighting how genetics, development, selection and the environment can lead to interdependencies among successive life stages, I wish to promote a holistic approach to studying complex life cycle parasites and emphasize that what happens in one stage is potentially highly relevant for later stages.

Sign in / Sign up

Export Citation Format

Share Document