A Key to the Larvae of Leaf-Mining Sawflies on Birch in Ontario with Notes on their Biology

1959 ◽  
Vol 91 (10) ◽  
pp. 625-627 ◽  
Author(s):  
O. H. Lindquist
Keyword(s):  
Large Scale ◽  
Scale Insect ◽  
Seasonal Occurrence ◽  
Immature Stages ◽  
Leaf Mining ◽  
Fenusa Pusilla ◽  
Forest Biology

The larvae of leaf-mining insects are difficult to rear in the laboratory and large-scale insect surveys must often rely on the identification of immature stages for their information. The need for a larval key to the birch leaf-mining saw-flies in Ontario became apparent when a complex of three species, Profenusa alumna (MacG.), Fenusa pusilla (Lep.), and Heterarthrus nemoratus (Fall.), was first discovered in 1955 (Lindquist 1955). Larvae of the three mentioned species have been described in recent years by Watson (1959), Friend (1933), and Peirson and Brower (1936), respectively. Additional descriptions of the larvae of F. pusilla and H. nemoratus were made by Daviault (1937). Information on distribution and seasonal occurrence was obtained from collections made by forest biology rangers over a 3-year period. Brief notes on the biology of the species, for comparison purposes, follows the larval key.

A mid-Cretaceous female scale insect (Hemiptera: Sternorrhyncha: Coccomorpha) in Burmese amber

Zootaxa ◽  
2020 ◽  
Vol 4810 (3) ◽  
pp. 511-522
Author(s):  
GEORGE POINAR ◽  
FERNANDO E. VEGA ◽  
SCOTT A. SCHNEIDER
Keyword(s):  
Special Interest ◽  
New Genus ◽  
Scale Insect ◽  
Morphological Features ◽  
The Body ◽  
Present Species ◽  
Immature Stages ◽  
Female Specimen ◽  
New Genus And Species ◽  
Burmese Amber

A new genus and species of scale insect (Hemiptera: Coccomorpha) is described from a female specimen in mid-Cretaceous Burmese (Myanmar) amber. Fossil female scales are rare and the present species, described as Paleolepidotus macrocolus gen. et sp. n., has such an unusual assortment of morphological features that it could not be assigned to any particular extant or extinct family. The small, ferruginous specimen exhibits a series of long wax pencils that extend around the body, including the head. The antennae and legs are quite long compared to other extant and extinct scale fossils. Of special interest are the protruding eyes, and a conical-triangular rostrum arising from between the forelegs; the claws with bifid apices are also unique. The ovisac contains immature stages. 

Biology of Caloptilia fraxinella (Lepidoptera: Gracillariidae) on ornamental green ash, Fraxinus pennsylvanica (Oleaceae)

2009 ◽  
Vol 141 (1) ◽  
pp. 31-39 ◽  
Author(s):  
M.L. Evenden
Keyword(s):  
Management Program ◽  
Biological Information ◽  
Fraxinus Pennsylvanica ◽  
Immature Stages ◽  
Green Ash ◽  
Emergence Period ◽  
Leaf Mining ◽  
Ash Trees ◽  
A Site ◽  
Caloptilia Fraxinella

AbstractThe ash leaf cone roller, Caloptilia fraxinella (Ely), is a leaf-mining moth that has recently become a significant pest of horticultural ash, Fraxinus L., species in communities throughout the western prairie provinces of Canada. The study examines the spatial and temporal within-host distribution of immature stages of C. fraxinella on green ash, Fraxinus pennsylvanica Marsh. Female C. fraxinella showed a preference for oviposition sites in the lower canopy and on the south side of the tree at the beginning and middle of the 3-week oviposition period, respectively, but no preference at the end of the period. Oviposition was constrained temporally and occurred mainly just after green ash bud flush. Immature stages were sampled throughout the growing season, and measured widths of larval head capsules showed five instars. Fourth-instar larvae disperse from the mined leaflet to a new leaflet, roll it into a cone, and pupate. Neither canopy height nor ordinal direction affected the position of larvae in the canopy, but numbers of immature stages varied by tree within a site. Female and male moths eclose from rolled leaf cones synchronously throughout the emergence period. The study provides some of the basic biological information required to design an integrated pest management program to target this emerging pest of horticultural ash trees.

scholarly journals Hawaiian Philodoria (Lepidoptera, Gracillariidae, Ornixolinae) leaf mining moths on Myrsine (Primulaceae): two new species and biological data

ZooKeys ◽  
2018 ◽  
Vol 773 ◽  
pp. 109-141 ◽  
Author(s):  
Shigeki Kobayashi ◽  
Chris A. Johns ◽  
Carlos Lopez-Vaamonde ◽  
Camiel Doorenweerd ◽  
Atsushi Kawakita ◽  
...  
Keyword(s):  
United States ◽  
New Species ◽  
Species Complex ◽  
Host Plants ◽  
Biological Data ◽  
Immature Stages ◽  
Leaf Mining ◽  
Diagnostic Characteristics ◽  
Two New Species ◽  
First Time

This paper provides new taxonomic and biological data on a complex of gracillariid moths in the endemic genus Philodoria Walsingham, 1907 that are associated with Myrsine (Primulaceae) in the Hawaiian Islands, United States. Two new species, Philodoriakauaulaensis Kobayashi, Johns & Kawahara, sp. n. (host: Myrsinelanaiensis, M.lessertiana, and M.sandwicensis) and P.kolea Kobayashi, Johns & Kawahara, sp. n. (host: M.lessertiana) are described. Biological data are provided for two previously described species that also feed on Myrsine: P.auromagnifica Walsingham, 1907 and P.succedanea Walsingham, 1907. For the first time we detail and illustrate genital structures, immature stages, biology, and host plants of P.auromagnifica and P.succedanea. Philodoriakolea, P.auromagnifica, and P.succedanea occur in sympatry on the island of Hawaii (Big Island), but each species differs in behavioral characters: P.kolea utilizes leaves of seedlings and forms a serpentine mine, whereas the latter two utilize leaves of larger plants, and form linear or serpentine to blotch mines. More broadly, leaf mine forms and diagnostic characteristics of the Myrsine-feeding species complex of Philodoria (as currently known) are reviewed and illustrated.

scholarly journals Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

2011 ◽  
Vol 71 (1) ◽  
pp. 91-98 ◽  
Author(s):  
IJ. Bechara ◽  
RHR. Destéfano ◽  
C. Bresil ◽  
CL. Messias
Keyword(s):  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Large Scale ◽  
Microbial Control ◽  
Fruit Fly ◽  
Control Agent ◽  
Immature Stages ◽  
Disease Cycle ◽  
Anastrepha Fraterculus ◽  
Hyphal Bodies

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

scholarly journals Insects: a novel animal-feed protein source for the Australian market

2019 ◽  
Vol 59 (11) ◽  
pp. 2037
Author(s):  
K. DiGiacomo ◽  
H. Akit ◽  
B. J. Leury
Keyword(s):  
Large Scale ◽  
Production Systems ◽  
Animal Feed ◽  
Animal Health ◽  
Food Additives ◽  
Companion Animals ◽  
Mass Rearing ◽  
Scale Insect ◽  
Insect Species ◽  
Feed Conversion

The increasing demands on natural resources to provide food and feed has led to increased global initiatives to improve production sustainability and efficiency. The use of insects as an alternate source of protein for human food and production-animal feed is one such avenue gaining attention. With there being a large variety of insect species endemic to each region, there is likely to be an ideal candidate for each specific production system and region. Insects require less land and water than do terrestrial animals, have high feed-conversion efficiency (FCE) and emit low levels of greenhouse gases (GHG). Insect species currently investigated for mass production include black soldier fly larvae (BSFL), mealworms and crickets. In western societies, it is less likely that wide-scale adoption of insects as a food source will occur, although speciality products with ‘hidden’ insects, such as cricket flour, are commercially available. It is likely to be more achievable for insects to be included into the diets of production and companion animals. While there has been significant investment in research and development of large-scale insect-production systems, such facilities are yet to start producing at a significant scale. The safety and efficacy of insects as a food or feed must be established in conjunction with the development of mass rearing facilities and the optimisation of insect-rearing substrates. Insects also have nutraceutical properties that may have beneficial impacts on animal health and growth, with scope for these properties to be exploited as feed or food additives. The present review will explore the following question: ‘are insects a future livestock industry for Australia?’.

Large-scale insect cell culture

1992 ◽  
Vol 2 (6) ◽  
pp. 340-341
Author(s):  
Mattheus F.A Goosen
Keyword(s):  
Cell Culture ◽  
Insect Cell ◽  
Large Scale ◽  
Scale Insect ◽  
Insect Cell Culture

Predicting seasonal occurrence of leatherback turtles (Dermochelys coriacea) in eastern Canadian waters from turtle and ocean sunfish (Mola mola) sighting data and habitat characteristics

2019 ◽  
Vol 97 (5) ◽  
pp. 464-478
Author(s):  
A. Mosnier ◽  
J.-F. Gosselin ◽  
J. Lawson ◽  
S. Plourde ◽  
V. Lesage
Keyword(s):  
Large Scale ◽  
Habitat Characteristics ◽  
Seasonal Occurrence ◽  
Dermochelys Coriacea ◽  
Seasonal Development ◽  
Eastern Canada ◽  
Leatherback Turtles ◽  
Western Atlantic ◽  
Ocean Sunfish ◽  
Mola Mola

Part of the western Atlantic population of leatherback turtles (Dermochelys coriacea (Vandelli, 1761)) forage in Canadian waters, where high-use areas have been identified using satellite telemetry and opportunistic sightings. Here, we use sightings of leatherback turtles and ocean sunfish (Mola mola (Linnaeus, 1758)) obtained during a systematic large-scale aerial survey, along with opportunistic turtle sightings, to examine the seasonal occurrence and distribution of leatherback turtles in eastern Canada. Using environmental correlates, we predict the spatial and seasonal development of potentially suitable habitats. All data sets confirmed the presence of leatherback turtles off Nova Scotia during summer. They also highlighted turtle occurrence off southern Newfoundland. Opportunistic sightings suggest a seasonal shift in main turtle concentrations from southwest to northeast, with use of southern Newfoundland waters extending into September. A generalized additive model linking environmental characteristics and turtle observations suggests adding the Grand Banks off Newfoundland and waters east of Anticosti Island in the Gulf of St. Lawrence to the potentially important habitat for leatherback turtles. Direct observations helped delineate habitat currently used by leatherback turtles. In the context of climate change, this modelling approach may improve our ability to forecast changes in turtle habitat suitability and the risks of entrapment or collision associated with potentially changing usage patterns.

Stenochironomus munteanpurin sp. n., a new leaf-mining species from Brazil (Diptera: Chironomidae)

Zootaxa ◽  
2018 ◽  
Vol 4382 (3) ◽  
pp. 553
Author(s):  
GIZELLE AMORA ◽  
NEUSA HAMADA ◽  
LUIZ. C. PINHO
Keyword(s):  
New Species ◽  
Adult Male ◽  
Related Species ◽  
Rio De Janeiro ◽  
The Other ◽  
Immature Stages ◽  
Life Stages ◽  
Santa Catarina ◽  
Leaf Mining ◽  
The One

Stenochironomus munteanpurin sp. n. is described and illustrated in all life stages, except eggs, from Brazil. The male is very similar to Stenochironomus quadrinotatus Borkent, 1984 due to same overall pattern of pigmentation. The new species can be distinguished from the other related species principally in immature stages: larva with labral lamella arranged in two groups with one or two conical-shaped teeth, spicules of pecten epipharyngis arranged in a row, unequal and irregularly distributed sizes, SI bifurcated, SII pinnate, SIII pinnate setae and, larval exuviae is compacted; pupa with shagreens being in all TI, less number of hooklets in TII, TVII without shagreens and presence of shagreen in conjunctive III/IV and IV/V. Adult male is very similar to the one of S. quadrinotatus but can be distinguished by combination of the TIX with more than 25 setae medially and phallapodeme curved anteriorly. The new species were collected in the following Brazilian states: Rio de Janeiro, Santa Catarina, Bahia and Acre. 

Sign in / Sign up

Export Citation Format

Share Document