scholarly journals Impact of Fungal Endophyte Colonization of Maize (Zea mays L.) on Induced Resistance to Thrips- and Aphid-Transmitted Viruses

Plants ◽  
2020 ◽  
Vol 9 (4) ◽  
pp. 416 ◽  
Author(s):  
Simon Kiarie ◽  
Johnson O. Nyasani ◽  
Linnet S. Gohole ◽  
Nguya K. Maniania ◽  
Sevgan Subramanian
Keyword(s):  
Integrated Management ◽  
Management Strategies ◽  
Fungal Endophyte ◽  
Eastern Africa ◽  
Maize Seeds ◽  
Fungal Isolates ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Maize Plants

In eastern Africa, Maize lethal necrosis (MLN) is caused by the co-infection of maize plants with Maize chlorotic mottle virus (MCMV) (Tombusviridae: Machlomovirus) and Sugarcane mosaic virus (SCMV) (Potyviridae: Potyvirus). With the disease being new to Africa, minimal effective management strategies exist against it. This study examined the potential of 10 fungal isolates to colonize maize plants and induce resistance against MCMV and SCMV. Maize seeds were soaked in fungal inoculum, sown and evaluated for endophytic colonization. Fungus-treated plants were challenge-inoculated with SCMV and/or MCMV to assess the effects of fungal isolates on the viruses in terms of incidence, severity and virus titers over time. Isolates of Trichoderma harzianum, Trichoderma atroviride and Hypocrea lixii colonized different plant sections. All plants singly or dually-inoculated with SCMV and MCMV tested positive for the viruses by reverse transcription-polymerase chain reaction (RT-PCR). Maize plants inoculated by T. harzianum and Metarhizium. anisopliae resulted in up to 1.4 and 2.7-fold reduced SCMV severity and titer levels, respectively, over the controls but had no significant effect on MCMV. The results show that both T. harzianum and M. anisopliae are potential candidates for inducing resistance against SCMV and can be used for the integrated management of MLN.

scholarly journals Maize Lethal Necrosis (MLN), an Emerging Threat to Maize-Based Food Security in Sub-Saharan Africa

2015 ◽  
Vol 105 (7) ◽  
pp. 956-965 ◽  
Author(s):  
George Mahuku ◽  
Benham E. Lockhart ◽  
Bramwel Wanjala ◽  
Mark W. Jones ◽  
Janet Njeri Kimunye ◽  
...  
Keyword(s):  
Food Security ◽  
Democratic Republic Of Congo ◽  
Management Strategies ◽  
Sub Saharan Africa ◽  
Eastern Africa ◽  
Smallholder Farming ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Sub Saharan

In sub-Saharan Africa, maize is a staple food and key determinant of food security for smallholder farming communities. Pest and disease outbreaks are key constraints to maize productivity. In September 2011, a serious disease outbreak, later diagnosed as maize lethal necrosis (MLN), was reported on maize in Kenya. The disease has since been confirmed in Rwanda and the Democratic Republic of Congo, and similar symptoms have been reported in Tanzania, Uganda, South Sudan, and Ethiopia. In 2012, yield losses of up to 90% resulted in an estimated grain loss of 126,000 metric tons valued at $52 million in Kenya alone. In eastern Africa, MLN was found to result from coinfection of maize with Maize chlorotic mottle virus (MCMV) and Sugarcane mosaic virus (SCMV), although MCMV alone appears to cause significant crop losses. We summarize here the results of collaborative research undertaken to understand the biology and epidemiology of MLN in East Africa and to develop disease management strategies, including identification of MLN-tolerant maize germplasm. We discuss recent progress, identify major issues requiring further research, and discuss the possible next steps for effective management of MLN.

scholarly journals Response of Assorted Maize Germplasm to the Maize Lethal Necrosis Disease in Kenya

2017 ◽  
Vol 6 (2) ◽  
pp. 65
Author(s):  
Sitta J. ◽  
Nzuve F. M. ◽  
Olubayo F. M. ◽  
Mutinda C. ◽  
Muiru W. M. ◽  
...  
Keyword(s):  
Inbred Lines ◽  
Sub Saharan Africa ◽  
Eastern Africa ◽  
Small Scale ◽  
Maize Productivity ◽  
Maize Genotypes ◽  
Severity Scores ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle

Maize (Zea mays L.) is the most widely grown staple food crop in Sub Saharan Africa (SSA) and occupies more than 33 million hectares each year. The recent outbreak and rapid spread of the Maize Lethal Necrosis (MLN) disease has emerged as a great challenge to maize production, threatening food security for the majority of households in the Eastern Africa region with yield loss estimated to be 50-90%. The disease is a result of synergistic interaction between two viruses, Sugarcane mosaic virus (SCMV) and Maize chlorotic mottle virus (MCMV). The objective of this study was to identify maize genotypes with resistance to MLN. In season one, 73 maize genotypes comprising 25 inbred lines from research institutes, 30 lines from the International Maize and Wheat Improvement Centre (CIMMYT) and 18 farmer varieties were screened for resistance to MLN. In season 2, only 48 genotypes were screened after some of the inbred lines showed complete susceptibility to MLN. These genotypes were grown in three replications in a completely randomized design in polythene bags in the greenhouse at the University of Nairobi. The plants were artificially inoculated using a mixture of SCMV and MCMV. .Weekly MLN disease severity scores using a scale of 1 to 5 (1 = highly resistant and 5 = highly susceptible) and % MLN incidence were recorded and eventually converted into Area under Disease Progress Curve (AUDPC) to give an indication of the disease intensity over time. The plants were allowed to grow to flowering stage to observe the effect of the MLN on the maize productivity. Analysis of Variance revealed wide genetic variation among the genotypes ranging from resistant to highly susceptible. In season 1, three farmer varieties namely MLR2, MLR11 and MLR13 showed resistance to MLN with a mean severity score of 2. In season 2, MLN12, MLN17, MLN18, MLN19, and MLR4 showed low MLN severity ranging from 2-3. The genotypes MLR6, MLR9, MLR16 and MLR18 showed MLN severity of 3 and early maturity traits. This study also validated the presence of MLN resistance among some CIMMYT lines depicted to show resistance in previous studies. These resistant genotypes could serve as donors in the introgression of the resistance into the adapted Kenyan maize backgrounds. This will go a long way in ensuring sustainable maize productivity while improving the livelihoods of the small-scale farmers who form the bulk of the major maize producers in Kenya.

Colorimetric detection of Maize chlorotic mottle virus by reverse transcription loop-mediated isothermal amplification (RT-LAMP) with hydroxynapthol blue dye

RSC Advances ◽  
2016 ◽  
Vol 6 (1) ◽  
pp. 73-78 ◽  
Author(s):  
Zhanmin Liu ◽  
Xueying Xia ◽  
Cuiyun Yang ◽  
Junyi Huang
Keyword(s):  
Reverse Transcription ◽  
Colorimetric Assay ◽  
Colorimetric Detection ◽  
Isothermal Amplification ◽  
Mottle Virus ◽  
Blue Dye ◽  
Maize Seeds ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle

Maize chlorotic mottle virus causes corn lethal necrosis disease, and can be transmitted via infected maize seeds. A colorimetric assay for the detection of Maize chlorotic mottle virus was developed which utilises RT-LAMP and hydroxynapthol blue dye (HNB).

Visual detection of Maize chlorotic mottle virus by asymmetric polymerase chain reaction with unmodified gold nanoparticles as the colorimetric probe

2016 ◽  
Vol 8 (38) ◽  
pp. 6959-6964 ◽  
Author(s):  
Lin Wang ◽  
Zhanmin Liu ◽  
Xueying Xia ◽  
Junyi Huang
Keyword(s):  
Polymerase Chain Reaction ◽  
Visual Detection ◽  
Mottle Virus ◽  
Chain Reaction ◽  
Maize Seeds ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Asymmetric Polymerase Chain Reaction ◽  
Polymerase Chain

Maize chlorotic mottle virus causes corn lethal necrosis disease and can transmit via infected maize seeds.

Genetic diversity of maize accessions for maizelethal necrosis disease resistance

2016 ◽  
Vol 51 (1) ◽  
Author(s):  
Patrick Ndakidemi ◽  
Mujuni Kabululu Sospeter ◽  
Joseph Ndunguru ◽  
Tileye Feyissa
Keyword(s):  
Genetic Diversity ◽  
Disease Resistance ◽  
Eastern Africa ◽  
Maize Production ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Maize Varieties ◽  
The World ◽  
Plant Characteristics

Maize is among the most preferred crop in Tanzania and other parts of the world. However, its production has been facing a number of challenges. Maize Lethal Necrosis Disease (MLND) is a new challenge in Eastern Africa. The control of MLND is said to be complicated as it is caused by a combination of more than one virus viz. Maize Chlorotic Mottle Virus (MCMV) and Sugarcane Mosaic Virus (SCMV). Stakeholders agree that the priority is to identify MLND resistant maize varieties. Genetic diversity provides the source of traits required against maize production challenges such as MLND. The study of genetic diversity in maize accessions often involves characterizing morphological plant characteristics as well as molecular marker techniques to study variation at DNA level. This review explores different literatures that address the importance of genetic diversity and the possibility of generating information towards obtaining potential materials against maize challenges and MLND in particular.

Real-time TaqMan RT-PCR for detection of maize chlorotic mottle virus in maize seeds

2011 ◽  
Vol 171 (1) ◽  
pp. 292-294 ◽  
Author(s):  
Yongjiang Zhang ◽  
Wenjun Zhao ◽  
Mingfu Li ◽  
Hongjun Chen ◽  
Shuifang Zhu ◽  
...  
Keyword(s):  
Real Time ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Maize Seeds ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle

scholarly journals Characterization of Maize miRNAs in Response to Synergistic Infection of Maize Chlorotic Mottle Virus and Sugarcane Mosaic Virus

2019 ◽  
Vol 20 (13) ◽  
pp. 3146
Author(s):  
Zihao Xia ◽  
Zhenxing Zhao ◽  
Xinran Gao ◽  
Zhiyuan Jiao ◽  
Yuanhua Wu ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Small Rnas ◽  
Expression Patterns ◽  
Sugarcane Mosaic Virus ◽  
Mottle Virus ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Maize Plants

The synergistic infection of maize chlorotic mottle virus (MCMV) and sugarcane mosaic virus (SCMV) causes maize lethal necrosis, with considerable losses to global maize production. microRNAs (miRNAs) are conserved non-coding small RNAs that play essential regulatory roles in plant development and environmental stress responses, including virus infection. However, the characterization of maize miRNAs in response to synergistic infection of MCMV and SCMV remains largely unknown. In this study, the profiles of small RNAs from MCMV and SCMV single- and co-infected (S + M) maize plants were obtained by high-throughput sequencing. A total of 173 known miRNAs, belonging to 26 miRNA families, and 49 novel miRNAs were profiled. The expression patterns of most miRNAs in S + M-infected maize plants were similar to that in SCMV-infected maize plants, probably due to the existence of RNA silencing suppressor HC-Pro. Northern blotting and quantitative real-time PCR were performed to validate the accumulation of miRNAs and their targets in different experimental treatments, respectively. The down-regulation of miR159, miR393, and miR394 might be involved in antiviral defense to synergistic infection. These results provide novel insights into the regulatory networks of miRNAs in maize plants in response to the synergistic infection of MCMV and SCMV.

scholarly journals First Report of Maize chlorotic mottle virus Infecting Sugarcane (Saccharum officinarum)

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 572-572 ◽  
Author(s):  
Q. Wang ◽  
X. P. Zhou ◽  
J. X. Wu
Keyword(s):  
Mosaic Virus ◽  
Yunnan Province ◽  
Saccharum Officinarum ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Total Rna ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Maize Plants

The experimental host range of Maize chlorotic mottle virus (MCMV) is restricted to the Gramineae (Poaceae) family with maize as a natural host. However, MCMV has never been found to infect sugarcane (Saccharum officinarum L.) plants in fields. MCMV can cause corn lethal necrosis disease (CLND) resulting from synergistic interaction between this virus and Maize dwarf mosaic virus (MDMV), Wheat streak mosaic virus (WSMV), or Sugarcane mosaic virus (SCMV) (1). MCMV was first found on maize plants in Yunnan Province in China in 2011 (2), and co-infection of MCMV and SCMV was reported on maize in Yunnan Province in China in 2013 (1). In January 2013, while surveying MCMV on maize in Yunnan Province, we found sugarcane planted near an MCMV-infected maize field with chlorotic and mosaic viral symptoms. Five symptomatic sugarcane plants were collected and screened for MCMV using a monoclonal antibody-based dot-ELISA (1). MCMV was detected in all five sugarcane samples using this assay. To further confirm the ELISA results, total RNA was isolated from sugarcane leaves using TRIzol reagent (Invitrogen, Carlsbad, CA) and assayed for MCMV by reverse transcription (RT)-PCR with primers M69F (ACAGGACACCGTTGCCGTTTAT) and M70R (CATGGGTGGGTCAAGGCTTACT) designed to amplify nt 3301 to 4282 of MCMV maize isolate YN2 (GenBank Accession No. JQ982468). The expected 982-bp amplicon was obtained from all five sugarcane samples confirming that the five sugarcane samples were infected with MCMV. Using purified total RNA as a template, RT-PCR was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and Pfusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) with primers M10 (AGGTAATCTGCGGCAACAGACC, 1 to 22 nt) and M36 (GGGCCGGAAGAGAGGGGCATTAC, 4436 to 4414 nt). The sequence of the resulting cDNA amplicon (KF010583) indicated that the MCMV sugarcane isolate shares 99% sequence identity with the MCMV maize isolate YN2 from Yunnan Province in China. Attempts to mechanically transmit MCMV from sugarcane to maize were unsuccessful. However, quantitative real time RT-PCR result revealed that the virus titer in sugarcane plants was about 6 to 10 times lower than that in maize plants (data not shown). SCMV was also detected in the five MCMV-infected sugarcane samples by RT-PCR with primers W48F (GTGTGGAATGGTTCACTCAAAGCTG) and W49R (GGTGTTGCAATTGGTGTGTACACG), designed to amplify a 395-bp fragment of the SCMV Beijing isolate (AY042184). The sequence of the amplified products shared 98% identity with SCMV isolate JP2 (JF488065). Thus, we think chlorotic and mosaic symptoms on the sugarcane plant samples were caused by co-infection of MCMV and SCMV and the sugarcane plants harbor both viruses implicated in causing maize lethal necrosis. This study indicates that MCMV naturally infects sugarcane plants. To our knowledge, this is the first report of MCMV infecting sugarcane plants. References: (1) J.-X. Wu et al. J. Zhejiang Univ-Sci B (Biomed & Biotechnol). 14:555, 2013. (2) L. Xie et al. J. Phytopathol. 159:191, 2011.

Sign in / Sign up

Export Citation Format

Share Document