scholarly journals Characterization of Maize miRNAs in Response to Synergistic Infection of Maize Chlorotic Mottle Virus and Sugarcane Mosaic Virus

2019 ◽  
Vol 20 (13) ◽  
pp. 3146
Author(s):  
Zihao Xia ◽  
Zhenxing Zhao ◽  
Xinran Gao ◽  
Zhiyuan Jiao ◽  
Yuanhua Wu ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Small Rnas ◽  
Expression Patterns ◽  
Sugarcane Mosaic Virus ◽  
Mottle Virus ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Maize Plants

The synergistic infection of maize chlorotic mottle virus (MCMV) and sugarcane mosaic virus (SCMV) causes maize lethal necrosis, with considerable losses to global maize production. microRNAs (miRNAs) are conserved non-coding small RNAs that play essential regulatory roles in plant development and environmental stress responses, including virus infection. However, the characterization of maize miRNAs in response to synergistic infection of MCMV and SCMV remains largely unknown. In this study, the profiles of small RNAs from MCMV and SCMV single- and co-infected (S + M) maize plants were obtained by high-throughput sequencing. A total of 173 known miRNAs, belonging to 26 miRNA families, and 49 novel miRNAs were profiled. The expression patterns of most miRNAs in S + M-infected maize plants were similar to that in SCMV-infected maize plants, probably due to the existence of RNA silencing suppressor HC-Pro. Northern blotting and quantitative real-time PCR were performed to validate the accumulation of miRNAs and their targets in different experimental treatments, respectively. The down-regulation of miR159, miR393, and miR394 might be involved in antiviral defense to synergistic infection. These results provide novel insights into the regulatory networks of miRNAs in maize plants in response to the synergistic infection of MCMV and SCMV.

Maize yellow mosaic virus interacts with maize chlorotic mottle virus and sugarcane mosaic virus in mixed infections, but does not cause maize lethal necrosis

Plant Disease ◽  
2021 ◽  
Author(s):  
Lucy R. Stewart ◽  
Kristen Willie
Keyword(s):  
Mosaic Virus ◽  
Sugarcane Mosaic Virus ◽  
Mottle Virus ◽  
Yellow Mosaic Virus ◽  
Mixed Infections ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Sequencing Studies ◽  
Yellow Dwarf Virus

A maize-infecting polerovirus, variously named maize yellow dwarf virus RMV2 (MYDV RMV2), MYDV-like, and maize yellow mosaic virus (MaYMV), is frequently found in mixed infections in plants also infected with maize chlorotic mottle virus (MCMV) and sugarcane mosaic virus (SCMV), known to synergistically cause maize lethal necrosis (MLN). MaYMV was discovered in deep sequencing studies precipitated by recent maize lethal necrosis (MLN) emergence and is prevalent at global locations with MLN, but its role in or contribution to disease was not known. We examined how MaYMV impacted disease development in mixed infections with MCMV, SCMV, and both MCMV and SCMV compared to mock inoculated plants. Results demonstrated that MaYMV symptoms included stunting as well as leaf reddening in single and mixed infections. MaYMV did not recapitulate MLN synergistic disease in double infections in which either MCMV or SCMV was missing (MaYMV + MCMV or MaYMV + SCMV), but did significantly enhance stunting in mixed infections, and suppressed titers of both MCMV and SCMV in double infections. Interestingly, MaYMV strongly suppressed the SCMV-induced titer increase of MCMV in triple infections, but MLN symptoms still occurred with the reduced MCMV titer. These data indicate the potential disease impact of this newly discovered ubiquitous maize virus, alone and in the context of MLN.

scholarly journals Response of Selected Maize Inbred Germplasm to Maize Lethal Necrosis Disease and Its Causative Viruses (Sugarcane Mosaic Virus and Maize Chlorotic Mottle Virus) in Kenya

2018 ◽  
Vol 12 (1) ◽  
pp. 215-226 ◽  
Author(s):  
James Karanja ◽  
John Derera ◽  
Augustine Gubba ◽  
Stephen Mugo ◽  
Ann Wangai
Keyword(s):  
Food Security ◽  
Mosaic Virus ◽  
Smallholder Farmers ◽  
Inbred Lines ◽  
Sugarcane Mosaic Virus ◽  
Mottle Virus ◽  
Maize Productivity ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle

Background: Maize lethal necrosis (MLN) disease continues to reduce the productivity of maize drastically threatening food security in the affected regions. It continues to cause yield loss of 30–100 percent in farmers’ fields, depending on the time of infestation which is valued at $198 million in Kenya. This has not only threatened regional trade, but also seed industry. It has been reported in the major maize belts of Uasin Gishu, Trans-Nzoia, Bomet, Narok and Nandi Counties. MLN is caused by the synergistic interaction between Sugarcane Mosaic Virus (SCMV) and Maize Chlorotic Mottle Virus (MCMV). The disease has then spread to other Eastern and Central African countries with devastating food security and economic consequences. Objectives: This study highlights result after screening selected maize inbred lines for resistance to MLN, SCMV and MCMV in identifying promising lines for integration into the breeding program for MLN resistance. Methods: Sixty-five (65) maize genotypes were artificially inoculated using virus strains collected from Bomet County in Kenya at 3-4 leaf stage. Data on disease severity and incidence, AUDPC and flowering were recorded. Results: From the result, the inbred lines had significant differences for SCMV, MCMV and MLN reactions. Based on Area Under Disease Progress Curve (AUDPC) score and ELISA analysis, genotypes MLN001 and MLN006 have the lowest score of 270, whereas OH28 had a maximum at 1259 under MCMV. Genotypes MLN042 and MLN041 were identified as the most promising sources of resistant against SCMV. However, no genotype was identified to have acceptable levels of tolerance to MLN, but MLN001 and MLN013 were identified as the best performers under MLN. This study also validated the presence of MLN tolerance in MLN013 (CKDHL120312) and MLN001 (CKDHL120918) as earlier reported by CIMMYT. These tolerant genotypes are now serving as donors in the introgression of the tolerance into the Kenyan adapted maize backgrounds and development of improved MLN tolerant varieties. This will go a long way in restoring and ensuring sustainable maize productivity in improving the livelihoods of the smallholder farmers who form 75% of the major maize producers in Kenya. Conclusion: The identified inbred lines would be recommended for use in varietal development, MLN management and to enhance maize productivity, in the MLN endemic regions and further research in understanding the mode of gene action for MLN tolerance.

scholarly journals First Report of Maize chlorotic mottle virus Infecting Sugarcane (Saccharum officinarum)

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 572-572 ◽  
Author(s):  
Q. Wang ◽  
X. P. Zhou ◽  
J. X. Wu
Keyword(s):  
Mosaic Virus ◽  
Yunnan Province ◽  
Saccharum Officinarum ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Total Rna ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Maize Plants

The experimental host range of Maize chlorotic mottle virus (MCMV) is restricted to the Gramineae (Poaceae) family with maize as a natural host. However, MCMV has never been found to infect sugarcane (Saccharum officinarum L.) plants in fields. MCMV can cause corn lethal necrosis disease (CLND) resulting from synergistic interaction between this virus and Maize dwarf mosaic virus (MDMV), Wheat streak mosaic virus (WSMV), or Sugarcane mosaic virus (SCMV) (1). MCMV was first found on maize plants in Yunnan Province in China in 2011 (2), and co-infection of MCMV and SCMV was reported on maize in Yunnan Province in China in 2013 (1). In January 2013, while surveying MCMV on maize in Yunnan Province, we found sugarcane planted near an MCMV-infected maize field with chlorotic and mosaic viral symptoms. Five symptomatic sugarcane plants were collected and screened for MCMV using a monoclonal antibody-based dot-ELISA (1). MCMV was detected in all five sugarcane samples using this assay. To further confirm the ELISA results, total RNA was isolated from sugarcane leaves using TRIzol reagent (Invitrogen, Carlsbad, CA) and assayed for MCMV by reverse transcription (RT)-PCR with primers M69F (ACAGGACACCGTTGCCGTTTAT) and M70R (CATGGGTGGGTCAAGGCTTACT) designed to amplify nt 3301 to 4282 of MCMV maize isolate YN2 (GenBank Accession No. JQ982468). The expected 982-bp amplicon was obtained from all five sugarcane samples confirming that the five sugarcane samples were infected with MCMV. Using purified total RNA as a template, RT-PCR was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and Pfusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) with primers M10 (AGGTAATCTGCGGCAACAGACC, 1 to 22 nt) and M36 (GGGCCGGAAGAGAGGGGCATTAC, 4436 to 4414 nt). The sequence of the resulting cDNA amplicon (KF010583) indicated that the MCMV sugarcane isolate shares 99% sequence identity with the MCMV maize isolate YN2 from Yunnan Province in China. Attempts to mechanically transmit MCMV from sugarcane to maize were unsuccessful. However, quantitative real time RT-PCR result revealed that the virus titer in sugarcane plants was about 6 to 10 times lower than that in maize plants (data not shown). SCMV was also detected in the five MCMV-infected sugarcane samples by RT-PCR with primers W48F (GTGTGGAATGGTTCACTCAAAGCTG) and W49R (GGTGTTGCAATTGGTGTGTACACG), designed to amplify a 395-bp fragment of the SCMV Beijing isolate (AY042184). The sequence of the amplified products shared 98% identity with SCMV isolate JP2 (JF488065). Thus, we think chlorotic and mosaic symptoms on the sugarcane plant samples were caused by co-infection of MCMV and SCMV and the sugarcane plants harbor both viruses implicated in causing maize lethal necrosis. This study indicates that MCMV naturally infects sugarcane plants. To our knowledge, this is the first report of MCMV infecting sugarcane plants. References: (1) J.-X. Wu et al. J. Zhejiang Univ-Sci B (Biomed & Biotechnol). 14:555, 2013. (2) L. Xie et al. J. Phytopathol. 159:191, 2011.

scholarly journals Extensive recombination challenges the utility of Sugarcane mosaic virus phylogeny and strain typing

2019 ◽  
Vol 9 (1) ◽  
Author(s):  
Luke Braidwood ◽  
Sebastian Y. Müller ◽  
David Baulcombe
Keyword(s):  
Distribution Pattern ◽  
Mosaic Virus ◽  
Sugarcane Mosaic Virus ◽  
Strain Typing ◽  
East African ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Cold Spots ◽  
The Impact

AbstractSugarcane mosaic virus (SCMV) is distributed worldwide and infects three major crops: sugarcane, maize, and sorghum. The impact of SCMV is increased by its interaction with Maize chlorotic mottle virus which causes the synergistic maize disease maize lethal necrosis. Here, we characterised maize lethal necrosis-infected maize from multiple sites in East Africa, and found that SCMV was present in all thirty samples. This distribution pattern indicates that SCMV is a major partner virus in the East African maize lethal necrosis outbreak. Consistent with previous studies, our SCMV isolates were highly variable with several statistically supported recombination hot- and cold-spots across the SCMV genome. The recombination events generate conflicting phylogenetic signals from different fragments of the SCMV genome, so it is not appropriate to group SCMV genomes by simple similarity.

Sign in / Sign up

Export Citation Format

Share Document