Real-time quantifications of dominant anaerobes in an upflow reactor by polymerase chain reaction using a TaqMan probe

2008 ◽  
Vol 57 (11) ◽  
pp. 1851-1855 ◽  
Author(s):  
D. W. Liang ◽  
T. Zhang ◽  
H. H. P. Fang

This study was conducted to demonstrate the application of quantitative real-time polymerase chain reaction (qRT-PCR) for the quantification of dominant bacteria in an anaerobic reactor using a designed TaqMan probe. A novel group of uncultured thermophilic bacteria affiliated with Thermotogales was first found in a phenol-degrading sludge from a 55°C upflow anaerobic sludge blanket (UASB) reactor, which effectively removed 99% of phenol at loading of 0.51 g-phenol l−1 d−1 h of hydraulic retention. A TaqMan probe was then designed targeting this group of Thermotogales affiliated bacteria (TAB), and used to monitor its concentration in the reactors. Results showed that the TAB population in the 55°C reactor increased proportional to the phenol degrading rate. Results also showed that the TAB population ranged 3.5–9.9% in the 55°C phenol-degrading sludge, but only 0.0044% in the 37°C sludge and 0.000086% in the 26°C sludge.

2005 ◽  
Vol 52 (1-2) ◽  
pp. 73-78 ◽  
Author(s):  
T. Zhang ◽  
S. Z. Ke ◽  
Y. Liu ◽  
H.P. Fang

Microbial properties of a methanogenic granular phenol-degrading sludge were characterized using the 16S rRNA/DNA-based techniques, including polymerase chain reaction (PCR) amplification, cloning, DNA sequencing, and fluorescence in situ hybridization (FISH). The sludge was sampled from an upflow anaerobic sludge blanket reactor, which removed 98% of phenol (up to 1260 mg/l) in wastewater at 26°C with 12 hours of hydraulic retention. Based on DNA analysis, the Eubacteria in the sludge was composed of 13 operational taxonomy units (OTUs). Two OTUs, one resembling Clostridium and the other remotely resembling Desulfotomaculum, were likely responsible for the conversion of phenol to benzoate, which was further degraded by five Syntrophus-resembling OTUs to acetate and H2/CO2; methanogens lastly converted acetate and H2/CO2 into methane. The role of six remaining OTUs remains unclear. Overall, the sludge was composed of 26±6% Eubacteria and 74±9% methanogens, of which 54±6% were acetotrophic Methanosaetaceae, 14±3% and 3±2% were hydrogenotrophic Methanomicrobiales and Methanobacteriaceae, respectively.


2017 ◽  
Vol 86 (4) ◽  
pp. 317-323
Author(s):  
Milena Alicja Stachelska

The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detectYersinia enterocoliticastrains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg ofYersinia enterocoliticain pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenicYersinia enterocoliticastrains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.


2021 ◽  
Vol 1 (2) ◽  
pp. 20-29
Author(s):  
Maria A E D Sihotang ◽  
Yola Eka Erwinda ◽  
Eniek Suwarni ◽  
Erita Lusianti

Daging tikus got (Rattus norvegicus) merupakan salah satu bahan yang kadang-kadang digunakan untuk campuran bakso sapi dan pangan olahan lain untuk menekan harga produksi. Hal ini sangat merugikan konsumen, baik dari segi kesehatan maupun kehalalan produk pangan. Untuk mencegah terjadinya hal tersebut, pengembangan metode uji untuk mendeteksi daging tikus got dalam pangan olahan sangat diperlukan. Salah satu metode yang mudah dan cepat dalam mengidentifikasi daging tikus got dalam pangan olahan adalah metode Polymerase Chain Reaction (PCR). Pengembangan metode endpoint PCR telah dilakukan, namun metode tersebut masih memiliki beberapa kekurangan dari segi spesifisitas dan kecepatan dalam perolehan hasil. pengembangan metode deteksi daging tikus got dengan metode real-time PCR perlu dikombinasikan dengan TaqMan probe yang lebih sensitif dan spesifik, sehingga dapat menjadi alternatif untuk pendeteksian daging tikus got dalam pangan olahan. Desain primer dan probe merupakan langkah awal dalam pengembangan metode deteksi dengan real-time PCR.  Penelitian ini bertujuan mendesain primer dan probe untuk deteksi gen mt-Co1 pada tikus got lalu dianalisis in silico. Sekuens gen mt-Co1 Rattus norvegicus (NC_001665.2) diperoleh dari pangkalan data National Center of Biotechnology Information (NCBI). Primer didesain menggunakan perangkat lunak Primer3Plus. Selanjutnya, beberapa kandidat primer dan probe dianalisis spesifisitasnya terhadap gen mt-CoI secara in silico menggunakan beberapa perangkat lunak, antara lain Primer-BLAST dan Nucleotide-BLAST. Primer dan probe yang spesifik terhadap gen mt-CoI pada tikus got (Rattus norvegicus) berhasil dikonstruksi dengan sekuens primer forward ATGAGCAAAAGCCCACTTTG; sekuen primer reverse CGGCCGTAAGTGAGATGAAT; dan probe GCAGGGATACCTCGTCGTTA. Primer dan probe ini dapat dimanfaatkan untuk pengembangan metode deteksi daging tikus pada bakso atau pangan olahan lain menggunakan real-time PCR dan TaqMan probe.


Author(s):  
Md. Mahfujur Rahman ◽  
Sharifah Bee Abd Hamid ◽  
Wan Jefrey Basirun ◽  
Subha Bhassu ◽  
Nur Raifana Abdul Rashid ◽  
...  

Sign in / Sign up

Export Citation Format

Share Document