TaqMan probe real‐time polymerase chain reaction targeting the ATPase 6 gene for the detection of pork adulteration in meat and meatballs

2019 ◽  
Vol 39 (6) ◽  
Author(s):  
Tri Joko Raharjo ◽  
Yusrina Nabila Chairani Chudori ◽  
Fransentino Wahyu Agustina
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Taqman Probe ◽  
Chain Reaction ◽  
Polymerase Chain ◽  
Atpase 6

scholarly journals Designing a time-effective TaqMan probe-based real-time polymerase chain reaction protocol for the identification of Yersinia enterocolitica in raw pork meat

2017 ◽  
Vol 86 (4) ◽  
pp. 317-323
Author(s):  
Milena Alicja Stachelska
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Yersinia Enterocolitica ◽  
Meat Products ◽  
Taqman Probe ◽  
Pork Meat ◽  
Chain Reaction ◽  
Microbial Risk ◽  
Polymerase Chain

The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detectYersinia enterocoliticastrains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg ofYersinia enterocoliticain pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenicYersinia enterocoliticastrains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.

Desain Primer dan Analisis in Silico untuk Amplifikasi Gen mt-Co1 pada Tikus got (Rattus norvegicus)

2021 ◽  
Vol 1 (2) ◽  
pp. 20-29
Author(s):  
Maria A E D Sihotang ◽  
Yola Eka Erwinda ◽  
Eniek Suwarni ◽  
Erita Lusianti
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Rattus Norvegicus ◽  
In Silico ◽  
Taqman Probe ◽  
Chain Reaction ◽  
Polymerase Chain

Daging tikus got (Rattus norvegicus) merupakan salah satu bahan yang kadang-kadang digunakan untuk campuran bakso sapi dan pangan olahan lain untuk menekan harga produksi. Hal ini sangat merugikan konsumen, baik dari segi kesehatan maupun kehalalan produk pangan. Untuk mencegah terjadinya hal tersebut, pengembangan metode uji untuk mendeteksi daging tikus got dalam pangan olahan sangat diperlukan. Salah satu metode yang mudah dan cepat dalam mengidentifikasi daging tikus got dalam pangan olahan adalah metode Polymerase Chain Reaction (PCR). Pengembangan metode endpoint PCR telah dilakukan, namun metode tersebut masih memiliki beberapa kekurangan dari segi spesifisitas dan kecepatan dalam perolehan hasil. pengembangan metode deteksi daging tikus got dengan metode real-time PCR perlu dikombinasikan dengan TaqMan probe yang lebih sensitif dan spesifik, sehingga dapat menjadi alternatif untuk pendeteksian daging tikus got dalam pangan olahan. Desain primer dan probe merupakan langkah awal dalam pengembangan metode deteksi dengan real-time PCR.  Penelitian ini bertujuan mendesain primer dan probe untuk deteksi gen mt-Co1 pada tikus got lalu dianalisis in silico. Sekuens gen mt-Co1 Rattus norvegicus (NC_001665.2) diperoleh dari pangkalan data National Center of Biotechnology Information (NCBI). Primer didesain menggunakan perangkat lunak Primer3Plus. Selanjutnya, beberapa kandidat primer dan probe dianalisis spesifisitasnya terhadap gen mt-CoI secara in silico menggunakan beberapa perangkat lunak, antara lain Primer-BLAST dan Nucleotide-BLAST. Primer dan probe yang spesifik terhadap gen mt-CoI pada tikus got (Rattus norvegicus) berhasil dikonstruksi dengan sekuens primer forward ATGAGCAAAAGCCCACTTTG; sekuen primer reverse CGGCCGTAAGTGAGATGAAT; dan probe GCAGGGATACCTCGTCGTTA. Primer dan probe ini dapat dimanfaatkan untuk pengembangan metode deteksi daging tikus pada bakso atau pangan olahan lain menggunakan real-time PCR dan TaqMan probe.

Real-time quantifications of dominant anaerobes in an upflow reactor by polymerase chain reaction using a TaqMan probe

2008 ◽  
Vol 57 (11) ◽  
pp. 1851-1855 ◽  
Author(s):  
D. W. Liang ◽  
T. Zhang ◽  
H. H. P. Fang
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Thermophilic Bacteria ◽  
Upflow Anaerobic Sludge Blanket ◽  
Taqman Probe ◽  
Uasb Reactor ◽  
Anaerobic Sludge ◽  
Chain Reaction ◽  
Polymerase Chain ◽  
Anaerobic Sludge Blanket

This study was conducted to demonstrate the application of quantitative real-time polymerase chain reaction (qRT-PCR) for the quantification of dominant bacteria in an anaerobic reactor using a designed TaqMan probe. A novel group of uncultured thermophilic bacteria affiliated with Thermotogales was first found in a phenol-degrading sludge from a 55°C upflow anaerobic sludge blanket (UASB) reactor, which effectively removed 99% of phenol at loading of 0.51 g-phenol l−1 d−1 h of hydraulic retention. A TaqMan probe was then designed targeting this group of Thermotogales affiliated bacteria (TAB), and used to monitor its concentration in the reactors. Results showed that the TAB population in the 55°C reactor increased proportional to the phenol degrading rate. Results also showed that the TAB population ranged 3.5–9.9% in the 55°C phenol-degrading sludge, but only 0.0044% in the 37°C sludge and 0.000086% in the 26°C sludge.

TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget

2015 ◽  
pp. 1-9
Author(s):  
Md. Mahfujur Rahman ◽  
Sharifah Bee Abd Hamid ◽  
Wan Jefrey Basirun ◽  
Subha Bhassu ◽  
Nur Raifana Abdul Rashid ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Polymerase Chain Reaction Assay ◽  
Taqman Probe ◽  
Chain Reaction ◽  
Chicken Nugget ◽  
Polymerase Chain
Sign in / Sign up

Export Citation Format

Share Document