In vitro binding of propranolol and progesterone to native and desialylated human orosomucoid

1983 ◽  
Vol 61 (10) ◽  
pp. 1114-1116 ◽  
Author(s):  
Allan K. L. Wong ◽  
J. Carleton Hsia
Keyword(s):  
Sialic Acid ◽  
Positive Charge ◽  
Equilibrium Dialysis ◽  
Electrostatic Attraction ◽  
Binding Ability ◽  
Sialic Acid Content ◽  
Physiological Conditions ◽  
Vitro Binding ◽  
Preferential Binding

A comparison of propranolol and progesterone binding to native and desialylated human orosomucoid was studied by means of equilibrium dialysis. The association constants of propranolol and progesterone binding to native human orosomucoid under physiological conditions were 8.4 × 105 and 3.2 × 105 M−1, respectively. Enzymatic desialylation of human orosomucoid removed 95% of the sialic acid content and reduced the binding affinity of propranolol from 8.4 × 105 to 6.0 × 105 M−1, but the affinity of progesterone was not affected. In addition, desialylation reduced the percent binding for propranolol, indicating that electrostatic attraction of the positive charge on propranolol by sialic acid residues on human orosomucoid had some effect on the binding ability of purified orosomucoid for propranolol. The present data suggest that the electrostatic attraction between sialic acid and propranolol is partially responsible for the preferential binding of basic drugs to orosomucoid in plasma.

scholarly journals The Regulator of Nitrate Assimilation in Ascomycetes Is a Dimer Which Binds a Nonrepeated, Asymmetrical Sequence

1998 ◽  
Vol 18 (3) ◽  
pp. 1339-1348 ◽  
Author(s):  
Joseph Strauss ◽  
M. Isabel Muro-Pastor ◽  
Claudio Scazzocchio
Keyword(s):  
Nitrate Assimilation ◽  
Binding Studies ◽  
Binding Ability ◽  
Zinc Cluster ◽  
First Case ◽  
Vitro Binding ◽  
Nitrate Induction ◽  
Dna Complex

ABSTRACT The regulation of nitrate assimilation seems to follow the same pattern in all ascomycetes where this process has been studied. We show here by in vitro binding studies and a number of protection and interference techniques that the transcription factor mediating nitrate induction in Aspergillus nidulans, a protein containing a binuclear zinc cluster DNA binding domain, recognizes an asymmetrical sequence of the form CTCCGHGG. We further show that the protein binds to its consensus site as a dimer. We establish the role of the putative dimerization element by its ability to replace the analogous element of the cI protein of phage λ. Mutagenesis of crucial leucines of the dimerization element affect both the binding ability of the dimer and the conformation of the resulting protein-DNA complex. This is the first case to be described where a dimer recognizes such an asymmetrical nonrepeated sequence, presumably by each monomeric subunit making different contacts with different DNA half-sites.

Colocalization of chaperone Cpn60, proinsulin and convertase PC1 within immature secretory granules of insulin-secreting cells suggests a role for Cpn60 in insulin processing

2000 ◽  
Vol 113 (11) ◽  
pp. 2075-2083 ◽  
Author(s):  
A.E. Arias ◽  
C.S. Velez-Granell ◽  
G. Mayer ◽  
M. Bendayan
Keyword(s):  
Islet Cell ◽  
Secretory Pathway ◽  
Secretory Granules ◽  
Double Labeling ◽  
In Vitro Binding ◽  
Cell Extracts ◽  
Vitro Binding ◽  
Preferential Binding ◽  
Insulin Secreting Cells

Many of the mechanisms that control insulin processing and packaging by interaction with different elements along the secretory pathway remain poorly understood. We have investigated the possibility that Cpn60, a member of the heat shock protein family, may be present in rat insulin-secreting cells, participating in the proinsulin-insulin maturation process. Immunofluorescence and high resolution immunocytochemical studies revealed the presence of the Cpn60 protein all along the insulin secretory pathway, being particularly abundant over the proinsulin-containing immature secretory granules. Double-labeling experiments showed associations between Cpn60 and proinsulin, as well as between Cpn60 and PC1 convertase, with a preferential binding to proinsulin. These findings paralleled those of coimmunoprecipitation studies showing the Cpn60 chaperone and the mature form of the PC1 convertase in proinsulin immunoprecipitates, as well as the PC1 in Cpn60 immunoprecipitates from total islet cell extracts. In vitro binding of Cpn60 to proinsulin, insulin and glucagon was also documented. Cpn60, significantly abundant in proinsulin-containing secretory granules where conversion of proinsulin to insulin takes place, and the colocalization of the chaperone with proinsulin and PC1 convertase suggest that the Cpn60 protein may play a role directing precise molecular interactions during insulin processing and/or packaging.

Partial resialylation of human asialotransferrin types 1 and 2 in the rat

1984 ◽  
Vol 62 (9) ◽  
pp. 853-858 ◽  
Author(s):  
Erwin Regoeczi ◽  
Paul A. Chindemi ◽  
Maria T. Debanne
Keyword(s):  
Sialic Acid ◽  
Electrophoretic Mobility ◽  
Acid Content ◽  
Sialic Acid Content ◽  
Small Doses ◽  
Type 3 ◽  
Time Type

125I-labeled asialotransferrin types 1 and 2 were administered in small doses to rats. The protein still in the plasma after 1–12 h was partially repurified and electrophoresed at pH 8.1, together with a transferrin standard that is composed of all six forms of the protein with respect to sialic acid content. The electrophoretic mobility of both asialotransferrins increased with time, type 2 being affected sooner than type 1. The changed mobility was due to increased electronegativity that was fully reversible by treatment of the samples with neuraminidase, thus identifying the underlying cause as partial resialylation. Asialotransferrin incubated in vitro with serum, plasma, or whole blood for 16 h exhibited no change in electrophoretic mobility. In conjunction with an earlier study on asialotransferrin type 3, it was found that the apparent speeds of resialylation of the three asialotransferrins were in the same order as their affinities for the asialoglycoprotein-binding hepatic lectin. This suggests the involvement of an endo- rather than of an ecto-transferase. Transfer of 59Fe from asialotransferrins to the liver was used to monitor the frequency of hepatocyte–asialotransferrin interactions. Iron deposition in the liver took place much more rapidly than the appearance of detectable quantities of partially resialylated asialotransferrin molecules in the circulation. It is concluded that each asialotransferrin molecule probably undergoes several passages through the hepatocyte before its glycans become modified.

In vitro Binding of Nitracrine to DNA in Chromatin

1989 ◽  
Vol 44 (3-4) ◽  
pp. 307-311 ◽  
Author(s):  
Dorota Wilmańska ◽  
Leszek Szmigiero ◽  
Marek Gniazdowski
Keyword(s):  
Reference Compound ◽  
Physiological Conditions ◽  
In Vitro Binding ◽  
Vitro Binding ◽  
Initial Decrease ◽  
Partial Dissociation ◽  
Sulfhydryl Compounds ◽  
Relative Accessibility ◽  
Apparent Influence

Abstract In the presence of sulfhydryl compounds nitracrine, an anticancer drug, binds covalently to DNA . The accessibility of DNA in chromatin both to nitracrine and to 8-methoxypsoralen. which was used as a reference compound in this study, when assayed in NaCl concentrations from 0 to 2 m show similar characteristics. The initial decrease reaches a minimum at 0.15 m NaCl above which dissociation of non-histone proteins and histones at higher ionic strengths is demonstrated by an increase in accessible sites. The relative accessibility of DNA in chromatin to nitracrine is, however, lower than that found for 8-methoxypsoralen. Partial dissociation of chromatin with 0.7 m NaCl increases the accessibility of DNA in chromatin when assayed in the absence of NaCl but has no apparent influence when estimated at ionic strength close to physiological conditions.

scholarly journals Zein/Bioactive Glass Coatings with Controlled Degradation of Magnesium under Physiological Conditions: Designed for Orthopedic Implants

Prosthesis ◽  
2020 ◽  
Vol 2 (3) ◽  
pp. 211-224 ◽  
Author(s):  
Muhammad Atiq Ur Rehman
Keyword(s):  
Bioactive Glass ◽  
Electrochemical Impedance ◽  
Composite Coatings ◽  
Orthopedic Implants ◽  
Open Circuit ◽  
Practical Application ◽  
Binding Ability ◽  
Physiological Conditions ◽  
Biomedical Device

Magnesium and its alloys are widely considered as temporary bio-implants owing to their mechanical properties and biocompatibility. However, the high corrosion rates and degradation in the physiological environment restrict the practical application of Mg as a biomedical device. Therefore, in this study, Zein/45S5 bioactive glass (BG) coatings were deposited via electrophoretic deposition (EPD) on pretreated pure magnesium (Mg) substrates, which controls the rapid degradation of magnesium. The set of EPD parameters was first optimized on stainless steel (SS) and then the optimum EPD parameters were applied to obtain zein/BG composite coatings on Mg substrates. The morphology of the obtained coatings was studied by scanning electron microscopy (SEM). SEM results showed that both zein and BG were successfully deposited on the surface of the Mg substrate. Electrochemical measurements consisting of open circuit potential (OCP), electrochemical impedance spectroscopy (EIS), and potentiodynamic polarization confirmed that the corrosion resistance of Mg improved after the deposition of zein/BG coatings. The in-vitro bioactivity study was carried out by immersing the zein/BG coatings in simulated body fluid for 3, 7, and 21 days. SEM, energy dispersive X-ray spectroscopy (EDX), and Fourier transform infrared spectroscopy results elucidated that the hydroxyapatite layer developed after 21 days of immersion in SBF, which confirmed the bone binding ability of the coatings.

Effect of desialylation of highly purified isoforms of human luteinizing hormone on their bioactivity in vitro, radioreceptor activity and immunoactivity

1997 ◽  
Vol 9 (5) ◽  
pp. 501 ◽  
Author(s):  
Patrick G. Burgon ◽  
Peter G. Stanton ◽  
Kim Pettersson ◽  
David M. Robertson
Keyword(s):  
Sialic Acid ◽  
Luteinizing Hormone ◽  
Acid Content ◽  
Specific Activity ◽  
Sialic Acid Residue ◽  
In Vitro Bioactivity ◽  
Human Pituitary ◽  
Sialic Acid Content ◽  
Before And After

To establish whether sialic acid content is responsible for an observed 7–8-fold variability in bioactivity in vitro of highly purified human pituitary luteinizing hormone (hLH) isoforms, the bioactivity in vitro, radioreceptor activity and immunoactivity of hLH isoforms were determined before and after enzymatic desialylation. Three immunofluorometric assays with different hLH specificities allowed characterization of 13–24 pituitary hLH isoform preparations of pI 7·03–8·98 in terms of sialic acid content (1–5 sialic acid residues per LH molecule), bioactivity in vitro (4030–30 000 I.U. mg-1), radioreceptor activity (6420–25 400 I.U. mg-1) and hLH immunoactivity (2900–4400 to 18 300–27 300 I.U. mg-1). Significant positive correlations between sialic acid content and either immunoactivity or in vitro bioactivity were observed, whereas radioreceptor activity showed a curvilinear response. Following more than 90% removal of sialic acid, both in vitro bioactivity and radioreceptor activity were increased, although specific activity still differed between isoforms; immunoactivities were unaffected. It is concluded that the presence of the sialic acid residue(s) on hLH isoforms does partially contribute to the in vitro bioactivity and radioreceptor activity of the isoforms, but that hLH immunoactivity is independent of sialic acid content.

Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor

2009 ◽  
Vol 62 (11) ◽  
pp. 1544 ◽  
Author(s):  
Elisabeth A. Owen ◽  
Max A. Keniry
Keyword(s):  
Fluorescence Emission ◽  
Myc Oncogene ◽  
Double Stranded Dna ◽  
Vitro Binding ◽  
G Quadruplex ◽  
Preferential Binding ◽  
Displacement Experiments ◽  
Order Of Magnitude ◽  
Dna Quadruplexes

Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.

Methyl 3β-(4-[125I]Iodophenyl)Tropane-2β-Carboxylate In Vitro Binding to Dopamine and Serotonin Transporters Under “Physiological” Conditions

2008 ◽  
Vol 62 (3) ◽  
pp. 978-986 ◽  
Author(s):  
Marc Laruelle ◽  
Suzanne S. Giddings ◽  
Yolanda Zea-Ponce ◽  
Dennis S. Charney ◽  
John L. Neumeyer ◽  
...  
Keyword(s):  
Serotonin Transporters ◽  
Physiological Conditions ◽  
In Vitro Binding ◽  
Vitro Binding

scholarly journals Isolation and characterization of a distinct immunoregulatory isoform of alpha-fetoprotein produced by the normal fetus.

1989 ◽  
Vol 170 (3) ◽  
pp. 811-825 ◽  
Author(s):  
N S van Oers ◽  
B L Cohen ◽  
R A Murgita
Keyword(s):  
Sialic Acid ◽  
Nk Cell ◽  
Cell Activity ◽  
Alpha Fetoprotein ◽  
Sialic Acid Content ◽  
Anion Exchange Column ◽  
Isolation And Characterization ◽  
Retention Volumes ◽  
Function Relationship

In this report, we examine the functional significance of the molecular microheterogeneity of alpha-fetoprotein (AFP). In doing so, we have taken the direct approach of purifying the naturally occurring isomeric forms of fetal-derived AFP using a preparative anion exchange column linked to an automated fast protein liquid chromatography (FPLC) system followed by parallel testing of each isolated molecular variant for in vitro immunoregulatory activity. The data obtained demonstrate the presence of seven distinct variants of AFP as defined by their retention volumes on FPLC elution profiles, by their pIs on analytical IEF gels, and by Western blot analysis. Molecular mass determination by SDS-PAGE showed each isomer to be equivalent in size to 69,000-dalton native unfractionated AFP molecules. All the immunosuppressive activity of AFP was localized to a single variant representing only 6% of the total composition of native AFP. The immunoregulating isomer termed AFP-1 was the least acidic of the seven isolated variants with a pI of 5.1 and displayed a sialic acid content of 1 mol/mol of protein. The inhibitory activity of AFP-1 could be readily measured on T cell-dependent antibody synthesis, Con A-induced stimulation of Lyt-1+23- thymocyte DNA synthesis, and lymphokine-activated NK cell activity. All other isomers were without effect in these test systems. The immunosuppressive AFP-1 isomer also displayed the strongest growth-promoting influence on cultured bone marrow lymphocytes. There was no correlation between functional activity and degree of expression of sialic acid residues on the AFP molecules. These findings demonstrate that the immunoregulating function of AFP is confined to a distinct and relatively small subpopulation of native AFP molecules and should therefore contribute to the resolution of outstanding questions regarding the structure/function relationship of this onco-fetal glycoprotein.

Heterogeneity of human luteinizing hormone. Effect of neuraminidase treatment on biologically active hormone and α- and β-subunits

1987 ◽  
Vol 114 (4) ◽  
pp. 577-583 ◽  
Author(s):  
L. A. van Ginkel ◽  
J. G. Loeber
Keyword(s):  
Sialic Acid ◽  
Sucrose Density Gradient ◽  
Biologically Active ◽  
Active Components ◽  
Charge Heterogeneity ◽  
Sialic Acid Content ◽  
Neuraminidase Treatment ◽  
Α Subunit ◽  
Isoelectric Focussing

Abstract. By preparative isoelectric focussing of a highly purified LH preparation in a sucrose density gradient, four biologically active LH components were isolated. The effect of neuraminidase treatment of each component on the charge heterogeneity was studied by isoelectric focussing followed by in vitro biological and immunochemical techniques. The number of biologically active components with pI-values > 7 containing varying amounts of sialic acid is at least six. The pI-value of the most basic (= asialo) LH component was 9.26. The two most basic components were not present in our preparation (NM 14) before neuraminidase treatment. It is concluded that the difference between the pI-values of LH components is caused by a difference in sialic acid content. When an intact LH component was incubated with neuraminidase there was detectable dissociation owing to the elevated temperature (37°C) and necessary acidic conditions of the incubation. Under these conditions we found the same subunits as we have described before. The most basic α-subunit had a pI-value of 9.29, whereas two β-subunits with pI > 9 were observed at pI 9.26 and pI 9.9. On the other hand, when an LH component was forced to dissociate by incubation at 56°C prior to neuraminidase digestion, two additional α-subunits were found. From this it is concluded that in the intact LH molecule, some sialic acid residues are poorer substrates for neuraminidase action than in the free subunits.

Sign in / Sign up

Export Citation Format

Share Document