Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor

2009 ◽  
Vol 62 (11) ◽  
pp. 1544 ◽  
Author(s):  
Elisabeth A. Owen ◽  
Max A. Keniry
Keyword(s):  
Fluorescence Emission ◽  
Myc Oncogene ◽  
Double Stranded Dna ◽  
Vitro Binding ◽  
G Quadruplex ◽  
Preferential Binding ◽  
Displacement Experiments ◽  
Order Of Magnitude ◽  
Dna Quadruplexes

Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.

Colocalization of chaperone Cpn60, proinsulin and convertase PC1 within immature secretory granules of insulin-secreting cells suggests a role for Cpn60 in insulin processing

2000 ◽  
Vol 113 (11) ◽  
pp. 2075-2083 ◽  
Author(s):  
A.E. Arias ◽  
C.S. Velez-Granell ◽  
G. Mayer ◽  
M. Bendayan
Keyword(s):  
Islet Cell ◽  
Secretory Pathway ◽  
Secretory Granules ◽  
Double Labeling ◽  
In Vitro Binding ◽  
Cell Extracts ◽  
Vitro Binding ◽  
Preferential Binding ◽  
Insulin Secreting Cells

Many of the mechanisms that control insulin processing and packaging by interaction with different elements along the secretory pathway remain poorly understood. We have investigated the possibility that Cpn60, a member of the heat shock protein family, may be present in rat insulin-secreting cells, participating in the proinsulin-insulin maturation process. Immunofluorescence and high resolution immunocytochemical studies revealed the presence of the Cpn60 protein all along the insulin secretory pathway, being particularly abundant over the proinsulin-containing immature secretory granules. Double-labeling experiments showed associations between Cpn60 and proinsulin, as well as between Cpn60 and PC1 convertase, with a preferential binding to proinsulin. These findings paralleled those of coimmunoprecipitation studies showing the Cpn60 chaperone and the mature form of the PC1 convertase in proinsulin immunoprecipitates, as well as the PC1 in Cpn60 immunoprecipitates from total islet cell extracts. In vitro binding of Cpn60 to proinsulin, insulin and glucagon was also documented. Cpn60, significantly abundant in proinsulin-containing secretory granules where conversion of proinsulin to insulin takes place, and the colocalization of the chaperone with proinsulin and PC1 convertase suggest that the Cpn60 protein may play a role directing precise molecular interactions during insulin processing and/or packaging.

scholarly journals Specific suppression of D-RNA G-quadruplex–protein interaction with an L-RNA aptamer

2020 ◽  
Vol 48 (18) ◽  
pp. 10125-10141 ◽  
Author(s):  
Mubarak I Umar ◽  
Chun Kit Kwok
Keyword(s):  
Protein Interaction ◽  
Protein Interactions ◽  
In Vitro Selection ◽  
Rna Aptamer ◽  
Stem Loop ◽  
Stem Loop Structure ◽  
G Quadruplex ◽  
Preferential Binding ◽  
Better Than

Abstract G-quadruplexes (G4s) are nucleic acid structure motifs that are of significance in chemistry and biology. The function of G4s is often governed by their interaction with G4-binding proteins. Few categories of G4-specific tools have been developed to inhibit G4–protein interactions; however, until now there is no aptamer tool being developed to do so. Herein, we present a novel L-RNA aptamer that can generally bind to D-RNA G-quadruplex (rG4) structure, and interfere with rG4–protein interaction. Using hTERC rG4 as the target for in vitro selection, we report the shortest L-aptamer being developed so far, with only 25 nucleotides. Notably, this new aptamer, L-Apt.4-1c, adopts a stem–loop structure with the loop folding into an rG4 motif with two G-quartet, demonstrates preferential binding toward rG4s over non-G4s and DNA G-quadruplexes (dG4s), and suppresses hTERC rG4–nucleolin interactions. We also show that inhibition of rG4–protein interaction using L-RNA aptamer L-Apt.4-1c is comparable to or better than G4-specific ligands such as carboxypyridostatin and QUMA-1 respectively, highlighting that our approach and findings expand the current G4 toolbox, and open a new avenue for diverse applications.

scholarly journals Activation-induced cytidine deaminase localizes to G-quadruplex motifs at mutation hotspots in lymphoma

NAR Cancer ◽  
2020 ◽  
Vol 2 (4) ◽  
Author(s):  
Ying-Zhi Xu ◽  
Piroon Jenjaroenpun ◽  
Thidathip Wongsurawat ◽  
Stephanie D Byrum ◽  
Volodymyr Shponka ◽  
...  
Keyword(s):  
B Cell ◽  
Cytidine Deaminase ◽  
B Cell Lymphoma ◽  
Dlbcl Patient ◽  
Myc Oncogene ◽  
G4 Dna ◽  
Activation Induced Cytidine Deaminase ◽  
G Quadruplex ◽  
Chromatin Immunoprecipitation Sequencing

Abstract Diffuse large B-cell lymphoma (DLBCL) is a molecularly heterogeneous group of malignancies with frequent genetic abnormalities. G-quadruplex (G4) DNA structures may facilitate this genomic instability through association with activation-induced cytidine deaminase (AID), an antibody diversification enzyme implicated in mutation of oncogenes in B-cell lymphomas. Chromatin immunoprecipitation sequencing analyses in this study revealed that AID hotspots in both activated B cells and lymphoma cells in vitro were highly enriched for G4 elements. A representative set of these targeted sequences was validated for characteristic, stable G4 structure formation including previously unknown G4s in lymphoma-associated genes, CBFA2T3, SPIB, BCL6, HLA-DRB5 and MEF2C, along with the established BCL2 and MYC structures. Frequent genome-wide G4 formation was also detected for the first time in DLBCL patient-derived tissues using BG4, a structure-specific G4 antibody. Tumors with greater staining were more likely to have concurrent BCL2 and MYC oncogene amplification and BCL2 mutations. Ninety-seven percent of the BCL2 mutations occurred within G4 sites that overlapped with AID binding. G4 localization at sites of mutation, and within aggressive DLBCL tumors harboring amplified BCL2 and MYC, supports a role for G4 structures in events that lead to a loss of genomic integrity, a critical step in B-cell lymphomagenesis.

scholarly journals Identification of optimal fluorescent probes for G-quadruplex nucleic acids through systematic exploration of mono- and distyryl dye libraries

2019 ◽  
Vol 15 ◽  
pp. 1872-1889 ◽  
Author(s):  
Xiao Xie ◽  
Michela Zuffo ◽  
Marie-Paule Teulade-Fichou ◽  
Anton Granzhan
Keyword(s):  
Rna Structure ◽  
Stokes Shift ◽  
Topological Classification ◽  
Fluorescent Light ◽  
Styryl Dyes ◽  
Dna And Rna ◽  
Double Stranded Dna ◽  
G4 Dna ◽  
G Quadruplex

A library of 52 distyryl and 9 mono-styryl cationic dyes was synthesized and investigated with respect to their optical properties, propensity to aggregation in aqueous medium, and capacity to serve as fluorescence “light-up” probes for G-quadruplex (G4) DNA and RNA structures. Among the 61 compounds, 57 dyes showed preferential enhancement of fluorescence intensity in the presence of one or another G4-DNA or RNA structure, while no dye displayed preferential response to double-stranded DNA or single-stranded RNA analytes employed at equivalent nucleotide concentration. Thus, preferential fluorimetric response towards G4 structures appears to be a common feature of mono- and distyryl dyes, including long-known mono-styryl dyes used as mitochondrial probes or protein stains. However, the magnitude of the G4-induced “light-up” effect varies drastically, as a function of both the molecular structure of the dyes and the nature or topology of G4 analytes. Although our results do not allow to formulate comprehensive structure–properties relationships, we identified several structural motifs, such as indole- or pyrrole-substituted distyryl dyes, as well as simple mono-stryryl dyes such as DASPMI [2-(4-(dimethylamino)styryl)-1-methylpyridinium iodide] or its 4-isomer, as optimal fluorescent light-up probes characterized by high fluorimetric response (I/I 0 of up to 550-fold), excellent selectivity with respect to double-stranded DNA or single-stranded RNA controls, high quantum yield in the presence of G4 analytes (up to 0.32), large Stokes shift (up to 150 nm) and, in certain cases, structural selectivity with respect to one or another G4 folding topology. These dyes can be considered as promising G4-responsive sensors for in vitro or imaging applications. As a possible application, we implemented a simple two-dye fluorimetric assay allowing rapid topological classification of G4-DNA structures.

In vitro binding of propranolol and progesterone to native and desialylated human orosomucoid

1983 ◽  
Vol 61 (10) ◽  
pp. 1114-1116 ◽  
Author(s):  
Allan K. L. Wong ◽  
J. Carleton Hsia
Keyword(s):  
Sialic Acid ◽  
Positive Charge ◽  
Equilibrium Dialysis ◽  
Electrostatic Attraction ◽  
Binding Ability ◽  
Sialic Acid Content ◽  
Physiological Conditions ◽  
Vitro Binding ◽  
Preferential Binding

A comparison of propranolol and progesterone binding to native and desialylated human orosomucoid was studied by means of equilibrium dialysis. The association constants of propranolol and progesterone binding to native human orosomucoid under physiological conditions were 8.4 × 105 and 3.2 × 105 M−1, respectively. Enzymatic desialylation of human orosomucoid removed 95% of the sialic acid content and reduced the binding affinity of propranolol from 8.4 × 105 to 6.0 × 105 M−1, but the affinity of progesterone was not affected. In addition, desialylation reduced the percent binding for propranolol, indicating that electrostatic attraction of the positive charge on propranolol by sialic acid residues on human orosomucoid had some effect on the binding ability of purified orosomucoid for propranolol. The present data suggest that the electrostatic attraction between sialic acid and propranolol is partially responsible for the preferential binding of basic drugs to orosomucoid in plasma.

scholarly journals RNA and DNA G-quadruplexes bind to human dicer and inhibit its activity

2021 ◽  
Vol 78 (7) ◽  
pp. 3709-3724
Author(s):  
Natalia Koralewska ◽  
Agnieszka Szczepanska ◽  
Kinga Ciechanowska ◽  
Marta Wojnicka ◽  
Maria Pokornowska ◽  
...  
Keyword(s):  
Genome Instability ◽  
Detailed Knowledge ◽  
Biological Processes ◽  
Binding Assays ◽  
Vitro Binding ◽  
Protein Interactome ◽  
G Quadruplex ◽  
Quadruplex Formation ◽  
Rna And Dna

AbstractGuanine (G)-rich single-stranded nucleic acids can adopt G-quadruplex structures. Accumulating evidence indicates that G-quadruplexes serve important regulatory roles in fundamental biological processes such as DNA replication, transcription, and translation, while aberrant G-quadruplex formation is linked to genome instability and cancer. Understanding the biological functions played by G-quadruplexes requires detailed knowledge of their protein interactome. Here, we report that both RNA and DNA G-quadruplexes are bound by human Dicer in vitro. Using in vitro binding assays, mutation studies, and computational modeling we demonstrate that G-quadruplexes can interact with the Platform–PAZ–Connector helix cassette of Dicer, the region responsible for anchoring microRNA precursors (pre-miRNAs). Consequently, we show that G-quadruplexes efficiently and stably inhibit the cleavage of pre-miRNA by Dicer. Our data highlight the potential of human Dicer for binding of G-quadruplexes and allow us to propose a G-quadruplex-driven sequestration mechanism of Dicer regulation.

Discrimination of monomer from multimer DNA disk-shaped toruses by freezeetch TEM

1984 ◽  
Vol 42 ◽  
pp. 210-211
Author(s):  
George C. Ruben ◽  
Kenneth A. Marx
Keyword(s):  
Biochemical Data ◽  
Dna Structures ◽  
Ice Surface ◽  
Double Stranded Dna ◽  
Data Support ◽  
Dna Organization ◽  
Trivalent Cations

In vitro collapse of DNA by trivalent cations like spermidine produces torus (donut) shaped DNA structures thought to have a DNA organization similar to certain double stranded DNA bacteriophage and viruses. This has prompted our studies of these structures using freeze-etch low Pt-C metal (9Å) replica TEM. With a variety of DNAs the TEM and biochemical data support a circumferential DNA winding model for hydrated DNA torus organization. Since toruses are almost invariably oriented nearly horizontal to the ice surface one of the most accessible parameters of a torus population is annulus (ring) thickness. We have tabulated this parameter for populations of both nicked, circular (Fig. 1: n=63) and linear (n=40: data not shown) ϕX-174 DNA toruses. In both cases, as can be noted in Fig. 1, there appears to be a compact grouping of toruses possessing smaller dimensions separated from a dispersed population possessing considerably larger dimensions.

Torus Circumference and Thickness Parameters From a Linear DNA Size Series Suggest How Toruses Self-Assemble

1985 ◽  
Vol 43 ◽  
pp. 522-523
Author(s):  
George C. Ruben ◽  
Kenneth A. Marx
Keyword(s):  
Tertiary Structure ◽  
Dna Complexes ◽  
Tertiary Structures ◽  
Self Assembling ◽  
Double Stranded Dna ◽  
Calf Thymus ◽  
Dna Organization ◽  
Condensed Dna ◽  
Dna Size

Certain double stranded DNA bacteriophage and viruses are thought to have their DNA organized into large torus shaped structures. Morphologically, these poorly understood biological DNA tertiary structures resemble spermidine-condensed DNA complexes formed in vitro in the total absence of other macromolecules normally synthesized by the pathogens for the purpose of their own DNA packaging. Therefore, we have studied the tertiary structure of these self-assembling torus shaped spermidine- DNA complexes in a series of reports. Using freeze-etch, low Pt-C metal (10-15Å) replicas, we have visualized the microscopic DNA organization of both calf Thymus( CT) and linear 0X-174 RFII DNA toruses. In these structures DNA is circumferentially wound, continuously, around the torus into a semi-crystalline, hexagonal packed array of parallel DNA helix sections.

In Vitro and in Vivo Comparison of Binding of 99m-Tc-Iabeled Anti-CEA MAb F33-104 with 99m-Tc-labeled Anti-CEA MAb BW431/26

1999 ◽  
Vol 38 (04) ◽  
pp. 115-119
Author(s):  
N. Oriuchi ◽  
S. Sugiyama ◽  
M. Kuroki ◽  
Y. Matsuoka ◽  
S. Tanada ◽  
...  
Keyword(s):  
Nude Mice ◽  
Binding Capacity ◽  
Colon Adenocarcinoma ◽  
Human Colon ◽  
Cell Binding ◽  
Vitro Binding ◽  
Labeling Method ◽  
Human Colon Adenocarcinoma

Summary Aim: The purpose of this study was to assess the potential for radioimmunodetection (RAID) of murine anti-carcinoembryonic antigen (CEA) monoclonal antibody (MAb) F33-104 labeled with technetium-99m (99m-Tc) by a reduction-mediated labeling method. Methods: The binding capacity of 99m-Tc-labeled anti-CEA MAb F33-104 with CEA by means of in vitro procedures such as immunoradiometric assay and cell binding assay and the biodistribution of 99m-Tc-labeled anti-CEA MAb F33-104 in normal nude mice and nude mice bearing human colon adenocarcinoma LS180 tumor were investigated and compared with 99m-Tc-labeled anti-CEA MAb BW431/26. Results: The in vitro binding rate of 99m-Tc-labeled anti-CEA MAb F33-104 with CEA in solution and attached to the cell membrane was significantly higher than 99m-Tclabeled anti-CEA MAb BW431/261 (31.4 ± 0.95% vs. 11.9 ± 0.55% at 100 ng/mL of soluble CEA, 83.5 ± 2.84% vs. 54.0 ± 2.54% at 107 of LS 180 cells). In vivo, accumulation of 99m-Tc-labeled anti-CEA MAb F33-104 was higher at 18 h postinjection than 99m-Tc-labeled anti-CEA MAb BW431/26 (20.1 ± 3.50% ID/g vs. 14.4 ± 3.30% ID/g). 99m-Tcactivity in the kidneys of nude mice bearing tumor was higher at 18 h postinjection than at 3 h (12.8 ± 2.10% ID/g vs. 8.01 ± 2.40% ID/g of 99m-Tc-labeled anti-CEA MAb F33-104, 10.7 ± 1.70% ID/g vs. 8.10 ± 1.75% ID/g of 99m-Tc-labeled anti-CEA MAb BW431/26). Conclusion: 99m-Tc-labeled anti-CEA MAb F33-104 is a potential novel agent for RAID of recurrent colorectal cancer.

The Effect of Adrenaline Infusions on Blood Coagulation in Normal and Haemophilia B Dogs

1966 ◽  
Vol 15 (03/04) ◽  
pp. 349-364 ◽  
Author(s):  
A.H Özge ◽  
H.C Rowsell ◽  
H.G Downie ◽  
J.F Mustard
Keyword(s):  
Body Weight ◽  
Factor Viii ◽  
Factor Ix ◽  
Clotting Factor ◽  
Blood Ph ◽  
Order Of Magnitude ◽  
Dose Dependent ◽  
Generation Test ◽  
Plasma Activity

SummaryThe addition of trace amounts of adrenaline to whole blood in plasma in vitro increased factor VIII, factor IX and whole plasma activity in the thromboplastin generation test. This was dose dependent.Adrenaline infusions less than 22 (μg/kg body weight in normal dogs accelerated clotting, increased factor IX, factor VIII and whole plasma activity in the thromboplastin generation test and caused a fall in blood pH. In a factor IX deficient dog, there was no increase in factor IX activity. After adrenaline infusions, however, the other changes occurred and were of the same order of magnitude as in the normal. Adrenaline in doses greater than 22 μg/kg body weight did not produce as great an effect on clotting in normal or factor IX deficient dogs. The platelet count in the peripheral blood was increased following the infusion of all doses of adrenaline. These observations suggest that the accelerating effect of adrenaline on clotting is not mediated through increase in activity of a specific clotting factor.

Sign in / Sign up

Export Citation Format

Share Document