An inexpensive medium for mass fermentation production of Entomophaga aulicae hyphal bodies competent to form conidia

1993 ◽  
Vol 39 (6) ◽  
pp. 588-593 ◽  
Author(s):  
Richard A. Nolan

A mass fermentation medium for growth and morphogenesis of the entomopathogenic fungus Entomophaga aulicae was developed. This fungus is a major pathogen of larval eastern hemlock looper and spruce budworm. The medium consists of a basal medium plus 0.8% tryptic soy broth and 0.4% calcium caseinate. This medium is a major breakthrough in that (i) the E. aulicae developmental sequence from protoplast inoculum to hyphal bodies competent to form conidia can be carried out in a single medium without adjustment, (ii) by examining the fermentation product it can be determined if conidia can be produced prior to engaging in costly field spraying, (iii) this medium supports the growth of E. aulicae isolates from different geographical areas, (iv) the medium is relatively inexpensive, (v) the hyphal bodies are easily separated from the spent growth medium, and (vi) the hyphal body yield is high.Key words: Entomophaga aulicae, mass fermentation medium, hyphal bodies, conidia, insect biocontrol.

1993 ◽  
Vol 39 (7) ◽  
pp. 701-708
Author(s):  
Richard A. Nolan

The effects of three different media on amino acid uptake and production and glucose and oxygen utilization during protoplast growth and hyphal body production by the fungus Entomophaga aulicae under fermentation conditions were studied. The three media consisted of a basal medium plus either (i) 2.8% fetal calf serum, (ii) 0.8% tryptic soy broth plus 0.4% bovine serum albumin, or (iii) 0.8% tryptic soy broth plus 0.4% calcium caseinate. The protoplasts grew most rapidly (initial peaks on days 2 and 3) and hyphal bodies were detected first (day 3) in the media containing albumin and caseinate. The day 9 hyphal body yields were 3.1 × 107, 7.5 × 108, and 3.1 × 109/10 L in media containing the serum, albumin, and caseinate, respectively. Growth in the albumin and caseinate media also gave the first detectable glucose utilization (days 2 and 3, respectively) and this rapidly increased to 94.9 and 90.6% utilization, respectively, on day 4. Oxygen and glucose utilization were closely related. During protoplast growth prior to hyphal body production, the only common pattern detected was the initial utilization of glutamine in serum- and caseinate-containing media. During the initial period of hyphal body production, cysteic acid, threonine, serine, asparagine, leucine, tyrosine, phenylalanine, and arginine were first utilized and glycine, alanine, and ammonia were first produced in the albumin and caseinate media. At this time (days 3–5), glutamine, proline, cystine, and tryptophan were first utilized and valine and histidine were produced in the albumin medium, and methionine was first utilized and cystathionine produced in the caseinate medium. Four main patterns of overall amino acid utilization and production were identified. The delay in major protoplast growth in the basal medium plus fetal calf serum is felt to result from inhibition by free fatty acids in the serum. Protein utilization was not detected and its main function is considered to be enhancement of protoplast stability against fermentation shear forces.Key words: Entomophaga aulicae, physiology, fermentation growth, protoplasts, hyphal bodies.


1989 ◽  
Vol 35 (2) ◽  
pp. 304-308 ◽  
Author(s):  
Gary B. Dunphy ◽  
Richard A. Nolan

The protoplast stages of Entomophaga aulicae grew in a medium based on the amino acid and amine composition of the hemolymph of the eastern hemlock looper, Lambdina fiscellaria fiscellaria. The optimum temperature and pH ranges for spindle-shaped protoplast growth were 15 to 25 °C and 5.5 to 6.5, respectively. Spindle-shaped protoplast development progressed asynchronously through the formation of mesoprotoplasts, elliptical mesoprotoplasts, and rod-shaped and spherical hyphal bodies. The production of these stages was not influenced by either medium pH or osmolality. Conidia were formed on conidiophores arising from spherical hyphal bodies near the surface of the culture medium. Changes in amino acid and amine levels during growth were correlated with the stage of fungal development. The major amino acids utilized during development included L-glutamine, L-asparagine, L-proline, L-leucine, L-isoleucine, L-tyrosine, and the amine O-phosphoethanolamine.Key words: Entomophaga aulicae, Lambdina fiscellaria fiscellaria, protoplasts, hemolymph, ninhydrin-positive compounds.


Weed Science ◽  
1990 ◽  
Vol 38 (4-5) ◽  
pp. 416-420 ◽  
Author(s):  
Hone L. Sun ◽  
Thomas J. Sheets ◽  
Frederick T. Corbin

A mixed microbial culture able to transform alachlor at a concentration of 50 μg ml-1was obtained from alachlor-treated soil after an enrichment period of 84 days. The microbial community was composed of seven strains of bacteria. No single isolate was able to utilize alachlor as a sole source of carbon. There was no alachlor left in the enriched culture after a 14-day incubation, but only 12% of the14C-ring-labeled alachlor was converted to14CO2through ring cleavage during 14 days in the basal medium amended with alachlor as a sole carbon source. The presence of sucrose as an alternative carbon source decreased the mineralization potential of the enriched culture, but sucrose increased the mineralizing ability of a three-member mixed culture. Thin-layer chromatographic analysis showed that there were four unidentified metabolites of alachlor produced by the enriched culture. Sucrose decreased the amount of two of the four metabolites. The absence of a noticeable decline in radioactivity beyond the initial 12% suggested that the side chain of alachlor was utilized as carbon source by the enriched culture. Little difference in radioactivity between growth medium and cell-free supernatant of the growth medium suggested that the carbon in the ring was not incorporated into the cells of the degrading microorganisms.


1996 ◽  
Vol 46 (3) ◽  
pp. 281-297 ◽  
Author(s):  
Najat Bhiry ◽  
Louise Filion

The mid-Holocene eastern hemlock [Tsuga canadensis L. (Carr.)] decline has been recently attributed to the activity of insect defoliators. N. Bihiry and L. Filion, Quaternary Research 45,312–320 (1996). In this study, soil hydromorphic conditions were investigated for the period 6800–3200 yr B.P. using micromorphological data from a peat section from a swale in a paludified dunefield in southern Québec. After a short period of plant colonization in shallow pools between 6800 and 6400 yr B.P., mesic conditions predominated in the interdune before the decline (6400–4900 yr B.P.), as evidenced by strong bioturbation and abundance of excrements from the soil fauna. During the decline, a shift from mesic to wet conditions occurred (4900–4100 yr B.P.), although xeric to mesic conditions persisted on dune ridges until at least 4200 yr B.P. Wetness culminated when beaver occupied the site (4100–3750 yr B.P.). Hemlock needles with chewing damage typical of hemlock looper (Lambdina fiscellaria) feeding were identified at levels dated 4900, 4600, and 4200 yr B.P., respectively, implying that the hemlock decline was associated with at least three defoliation events. The ca. 400-yr interval between these events likely represents the time required for this late-sucessional tree species to recover.


1976 ◽  
Vol 54 (13) ◽  
pp. 1419-1437 ◽  
Author(s):  
Martha J. Powell

As the fungus Coelomomyces punctatus develops in the coelomic cavity of the mosquito Anopheles quadrimaculatus, the conformation of the plasma membrane and extracellular coat of the fungus changes markedly. The vegetative stage was surrounded by a granular and fibrillar extracellular coat which reacted positively in the silver methenamine procedure for the localization of polysaccharides. Numerous simple, branched or contorted cytoplasmic protuberances covered the irregularly shaped hyphal bodies. The surface of the hyphal body adjacent to the fat body of the mosquito had occasional involutions of the plasma membrane sheathed by cisternae of endoplasmic reticulum. In contrast with these hyphal bodies, cytoplasmic protuberances were spaced at wide intervals along filamentous hyphae. Aborting thalli were contorted and deeply lobed. The plasma membrane was smooth, and cytoplasmic protuberances were absent on other hyphae and hyphal bodies, particularly at advanced stages of infection. Instead unattached vesicles, morphologically similar to the protuberances found on some thalli, were embedded in granular material clustered around the smooth plasma membrane of these thalli. Mosquito hemocytes appeared to engulf these vesicles and granular material. As the vegetative stage was transformed into the reproductive stage, a newly formed, compact extracellular layer surrounded the sporangial initial. Later, a darkly staining wall appeared around the resting sporangium. Cisternae of endoplasmic reticulum consistently subtended thin areas in this pitted wall.


1952 ◽  
Vol 30 (4) ◽  
pp. 208-212 ◽  
Author(s):  
T. A. Angus

A study was made of healthy hemlock loopers (Lambdina fiscellaria Gn.) to determine whether a specific bacterial flora is associated with this insect. Larvae, pupae, adults, and eggs were examined by a number of methods and the bacteria found were cultured and classified. Organisms belonging to nine genera of bacteria were isolated and they were principally of foliage-contaminating or soil types that could be ingested with the insects' food. Few of the ingested bacteria survive the digestive process. It is concluded that the bacterial flora is adventitious.


Author(s):  
S. J. Ameh ◽  
C. U. Aguoru ◽  
C. C. Iheukwumere ◽  
O. J. Olasan ◽  
U. J. Alfred

Aims: Micro propagation of P. santalinoides was carried out in order to ascertain the most appropriate culture media for its micro propagation. Study Design: The experiment was laid out in different growth media in the laboratory. Place and Duration of Study: The micro propagation of Pterocarpus santalinoides was carried out at the Tissue culture laboratory of the University of Nigeria, Nsukka and lasted between July and October 2018. Methodology: Seeds from fresh and healthy ripe fruit which was cut open mechanically with the help of secateurs were gotten from Ai-kwu, Otukpa Local Government Area of Benue State, Nigeria. The seeds were air dried and used as explant. The explants were surface sterilized using NaOCl solution for 10 mins, rinsed with distilled water and then the soft seed coat were removed and the seeds were cultured under aseptic conditions on MS medium and other growth medium. Seeds of Pterocarpus santalinoides were inoculated on six different growth media with varying compositions. The media are MS, B5 and white’s without growth hormones (MSoo, B5oo, and WHoo), and each of them was supplemented with 3.0 mgl-1 BAP and 0.5 mgl-1 NAA (MSBN, B5BN, WHBN). Results: Seed germination improved in all the media studied. However, MS combinations gave the best result (90-93%). The maximum number of leaves and roots recorded was in MSBN (3.8 for leaves and 2 for roots) followed by MSoo (2.6) and WHBN (2.6). The leaf area was best for the MS combination (0.232 cm2) followed by the White’s combinations (0.154 cm2) and least for the B5 combinations (0.026 cm2) while shoot and root length was maximum in MSBN (4.28 cm for the shoot and 1.18 cm for the root) followed by WHBN (1.90 cm). The result for t-test revealed that there was a significant difference between the parameters studied for growth media with growth hormones and those without growth hormones. The recorded percentage germination rate for MS medium without growth hormone was 90.75±0.97 while MS medium supplemented with growth hormone was 93.25±0.25. B5 medium without growth medium was 60.25±0.50 and when supplemented with growth hormone, the value was 66.50±0.57. White medium without growth hormone had a value of 75.25±1.70 and when supplemented with growth hormone the value was 78.0±0.81. Conclusion: The growth rates of Pterocarpus santalinoides, in MS medium among other basal media (B5 and White) offers a compromise between all the growth parameters which indicates that variation of the basal medium composition could lead to enhanced Pterocarpus santalinoides regeneration efficiency.


2011 ◽  
Vol 71 (1) ◽  
pp. 91-98 ◽  
Author(s):  
IJ. Bechara ◽  
RHR. Destéfano ◽  
C. Bresil ◽  
CL. Messias

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.


1972 ◽  
Vol 104 (10) ◽  
pp. 1511-1514 ◽  
Author(s):  
Imre S. Otvos ◽  
David G. Bryant

AbstractSoaking shredded moss and birch bark samples in a 2% bleach solution for 45 minutes will release attached hemlock looper eggs. Soaking has no deleterious effect on the hatching of larvae or the emergence of parasites. This technique, in contrast to direct examination, results in a significant increase in the number of eggs obtained and a decrease in counting time. It also permits the development of egg sampling techniques for use over extensive areas and the collection of eggs in large numbers.


Sign in / Sign up

Export Citation Format

Share Document