Callery pear (Pyrus calleryana) Response to Fire in a Managed Prairie Ecosystem

2018 ◽  
Vol 11 (1) ◽  
pp. 27-32
Author(s):  
Adam R. Warrix ◽  
Jordan M. Marshall

AbstractCallery pear (Pyrus calleryana Decne.) was introduced to North America as an ornamental tree in the early 1900s. Due to widespread planting, P. calleryana has become common throughout the eastern United States and has invaded natural areas, especially disturbed areas. Prescribed fire is a common management technique in prairie ecosystems to mimic natural disturbances. We tested the effectiveness of prescribed fire as a control technique for P. calleryana in a managed prairie system. Fire top-killed all established P. calleryana individuals. However, these individuals responded to fire with 3 to 4 epicormic sprouts each. Similar sprouting behavior occurred in 2-yr-old seedlings. Exposed seeds, fruits, and 1-yr-old seedlings were killed by fire. Established P. calleryana were single-stemmed individuals before exposure to fire. After the prescribed fire, they all were multistemmed, which increased the potential flower-bearing stems within the prairie. We conclude that fire alone is not a suitable technique for managing P. calleryana invasion. Cut and herbicide application methods are labor-intensive. However, combining cut and spray methods with prescribed fire may be effective. Fire removes standing grass and forb biomass, leaving exposed P. calleryana stems, which would make locating individuals and directly applying herbicides easier.

2021 ◽  
pp. 1-5
Author(s):  
David R. Coyle ◽  
Brayden M. Williams ◽  
Donald L. Hagan

Callery pear (Pyrus calleryana) is an invasive tree across much of the eastern United States that can form dense thickets, and tree branches and stems are often covered in sharp thorns. Landowners and land managers attempting to manage callery pear infestations are faced with the challenge of killing and/or removing the trees while also avoiding thorn damage to equipment, which can lead to wasted time and increased costs. We evaluated fire as management tool to reduce the likelihood of equipment damage from callery pear thorns. Branches were collected in the field from callery pear trees that were killed by herbicide, and also from untreated trees, and half the branches from each group were then burned with a propane garden torch to simulate a low-intensity prescribed fire. After treatment, all branches were returned either to an old field or forest floor for 1 year, after which thorn puncture strength was evaluated and compared with freshly cut thorns. Herbicide treatment and location did not affect thorn strength, but burning reduced the likelihood that thorns would puncture a tire. Fire increased tip width, which reduced thorn sharpness. Burning also reduced wood strength, and fungi proliferated on burned thorns after 1 year in the field or forest. Both factors likely contributed to decreasing thorn strength and probability of puncture. Our results show that using prescribed fire as a management tool can weaken callery pear thorns and dull their tips, reducing the chance of equipment damage and costs associated with clearing land of this invasive species. Leaving cut callery pear trees on the ground for 1 year increased fungal colonization, which may also reduce thorn damage. Prescribed fire can be part of an effective integrated management plan for this, and possibly other, thorny invasive flora.


Author(s):  
James T. Vogt ◽  
David R. Coyle ◽  
David Jenkins ◽  
Chris Barnes ◽  
Christopher Crowe ◽  
...  

Abstract Callery pear (Pyrus calleryana Decne.) is rapidly spreading in the United States, gaining attention in the last two decades as a serious invasive pest. Recommended control methods include foliar, basal bark, cut stump, and hack-and-squirt application of herbicides, but there are few published studies with replicated data on efficacy. Four readily available herbicidal active ingredients and a combination of two active ingredients were tested for control efficacy against P. calleryana in old-field areas and loblolly pine (Pinus taeda L.) understory. Basal bark applications (triclopyr, triclopyr + aminopyralid), foliar applications (glyphosate, imazapyr), and a soil application (hexazinone) effectively killed P. calleryana with the exception of hexazinone at one site, where rainfall may not have been optimal. Foliar application of glyphosate provided the most consistent control. Our results demonstrate efficacy of registered herbicide formulations for P. calleryana control in two geographic locations and two habitat types. The need for development of integrated pest management programs for P. calleryana is discussed.


2012 ◽  
Vol 21 (3) ◽  
pp. 210 ◽  
Author(s):  
Lenya N. Quinn-Davidson ◽  
J. Morgan Varner

Though the need for prescribed fire is widely recognised, its use remains subject to a range of operational and social constraints. Research has focussed on identifying these constraints, yet past efforts have focussed disproportionately on single agencies and geographic regions. We examined constraints on prescribed fire by surveying a wide variety of organisations (including six state and federal agencies and several tribes, non-governmental organisations and timber companies) in northern California, a fire-prone region of the western United States. Across the region, prescribed burning annually covered only 38% of the area needed to fulfil land-management objectives, and 66% of managers indicated dissatisfaction with levels of prescribed fire activity. The highest-ranked impediments were narrow burn window, regulations, lack of adequate personnel and environmental laws. Impediment ratings differed among entities, with legal and social impediments of greater concern in the private sector than in the public, and economic impediments of greater concern in the state and private sectors than in the federal. Comparisons with the south-eastern United States, where similar research has taken place, point to important regional constraints on prescribed fire activity. These findings suggest further need for research spanning geographic and ownership boundaries, as prescribed fire impediments can vary by context.


Author(s):  
Pablo Ballesteros-Pérez ◽  
Kamel Mohamed Elamrousy

A significant proportion of projects across the construction industry fail to meet their planned completion dates, being this a recurrent topic in the project management literature. Multiples causes of project delays have been proposed, however, hardly any attention has been paid to the fact that the most celebrated project monitoring and control technique – the Earned Value Management (EVM) – may not be as fit for purpose as it seems. It is proposed that because EVM ignores activity duration variability it always results in optimistic completion dates which may be very difficult to meet in the real projects. This research offers a fresh and long overdue critique of EVM in its most common implementation (assuming deterministic activity durations and costs), while highlighting its shortcomings. Particularly, Monte Carlo simulations are implemented to exemplify how the merge event bias phenomenon is inadvertently impacting the schedule in both time and cost dimensions. A fictitious case study is used to demonstrate the connection between these shortcomings and what is then conceived as a delay in project completion.


Plant Disease ◽  
2010 ◽  
Vol 94 (2) ◽  
pp. 279-279 ◽  
Author(s):  
A. M. Minnis ◽  
A. Y. Rossman ◽  
D. L. Clement ◽  
M. K. Malinoski ◽  
K. K. Rane

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana ‘Cleveland Select’ showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5′-3′ ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana ‘Chanticleer’, in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.


2020 ◽  
pp. 1-29
Author(s):  
Richard L. Boyce ◽  
Miciah Ocasio

Abstract Pyrus calleryana Decne. (Callery pear), a native of eastern Asia, has recently emerged as an important woody invader in much of the eastern U.S. Little is known about its ecology in its new range. Its shade tolerance may be an important indicator of areas it is likely to invade. In this study, allometric equations were first developed to predict aboveground biomass components, including wood, branches, bark, leaves, and fruit, from diameter at stump height (dsh; 25 cm), by destructively harvesting 13 trees, ranging from 0.1 to 19.3 cm dsh. Then, a total of 23 wild-grown stands in the northern Kentucky/southwestern Ohio region were surveyed, with diameters of all woody stems sampled. Pyrus calleryana density, basal area, aboveground biomass, stand density index, size distribution inequality, and importance value were calculated for each site. Two-factor Weibull distributions were fit to diameter distributions. Allometric equations provided good fits for total aboveground biomass as well as individual components. Aboveground biomass levels fell below mean levels of native forest stands found in the US. Stand density indices yielded values typical of shade-intolerant or midtolerant species. Stands with smaller trees generally had steeply declining monotonic diameter distributions, while stands with larger, trees trended toward positively-skewed monotonic distributions. These findings are consistent with a species that is either shade-intolerant or midtolerant. Thus, while this species is expected to invade open or disturbed areas, it is not expected to be an important invader under forest canopies. However, its extended deciduous habit is one shared by other understory woody invaders, and so this may allow it to survive under forest canopies. Management Implications Callery pear, which has been used in landscape plantings for decades, is now being recognized as important woody invader in much of the eastern U.S. However, little is known now about its impact on native forest stands. Here, we developed allometric equations to predict aboveground biomass components, including wood, branches, bark, leaves, and fruit, as well as total aboveground biomass, from diameter at stump height (dsh; 25 cm) measurements; dsh often works better than dbh (diameter at breast height; 1.37 m) with this species because pear stems often fork below breast height. However, there is a strong relationship between dsh and dbh, so these allometric equations can used with dbh measurements. Most biomass equations were log-log regressions, and they were corrected for bias using the UMVU estimator. However, this estimator does not give a ready-to-use equation; the original data must be used along with collected data in an R routine. Thus, we also report equations corrected with the smearing estimate, which, while not as good as the UMVU estimator, performs better than most commonly used estimators. The allometric equations will allow managers to estimate biomass of stands dominated by Callery pear. Diameter distributions from 23 wild-grown stands in the northern Kentucky/southwestern Ohio region were fit to two-factor Weibull distributions, which indicated a species that is either shade-intolerant or midtolerant, which was also indicated by relatively low stand density indices. For managers, this suggests that control efforts for Callery pear should focus on disturbed or open areas, as our results suggest that it will not become an important invader in closed-canopy forests.


2005 ◽  
Vol 23 (2) ◽  
pp. 108-111 ◽  
Author(s):  
Tim Abbey ◽  
Tom Rathier

Abstract The addition of commercial mycorrhizal, transplant gel and/or biostimulant products to the root balls or backfill soil of Japanese holly, (Ilex crenata Thunb. ‘Green Luster’); arborvitae, (Thuja occidentalis L. ‘Emerald Green’); Japanese spirea, (Spiraea japonica L.f. ‘Shibori’); Bradford Callery pear, (Pyrus calleryana Decne. ‘Cleveland Select’ and ‘Redspire’) at the time of planting did not lead to significant improvement of plant growth or transplant survival compared to untreated plants receiving routine mulching with pine bark mulch alone.


2015 ◽  
Vol 2015 ◽  
pp. 1-14 ◽  
Author(s):  
Inseok Yang ◽  
Dongik Lee

This paper proposes intelligent fault-tolerant control technique using network. Not only control commands generated by a controller but also diagnostic data for tolerating failures can be transmitted through network. In this paper, fault-tolerant control allocation method (FTCA) is proposed to tolerate failures in more than one actuator. FTCA is based on a well-known actuator management technique called control allocation (CA). While the conventional CA is used to redistribute actuators optimally, FTCA redistributes actuators to compensate for the performance degradation due to actuator failure. To analyze the effects of faulty actuator, this paper proposes the general model of the faulty system firstly. And then the modified CA for tolerating the effect of failure is proposed. The performance of the proposed FTCA method is verified by the numerical simulations with application to F-18 High Alpha Research Vehicle (HARV).


2007 ◽  
Vol 33 (2) ◽  
pp. 153-156
Author(s):  
Henry Gerhold

Cooperators in the Municipal Tree Restoration Program planted nine Callery pear (Pyrus calleryana Decne.) cultivars in 11 Pennsylvania, U.S. communities for evaluation as street trees, comparing two cultivars (three in one case) in each community. Cooperators measured them annually with standardized methods for 3 years and then at 3-year intervals until the 12th year. The most noteworthy differences occurred in tree height and crown width. The tallest were Aristocrat™, ‘Cleveland Select’, and ‘Redspire’, attaining more than 8 m (26 ft) on average by the twelfth year and even 10.3 m (34 ft) in one community. ‘Autumn Blaze’, evaluated only at one location, was ≈1.5 to 2 m (5 to 6.6 ft) shorter in the 12th year. Heights of the other cultivars, tested at just one or two locations, were similar to the tallest ones. Crown widths differed more in the first 9 years than at the twelfth when on average most were ≈6.5 m (21.5 ft) wide. Cleveland Pride ®, ‘Cleveland Select’, Valiant ®, and ‘Whitehouse’ were narrower than the others until the ninth year, but only ‘Cleveland Select’ at ≈5.6 m (18.5 ft) remained narrower in the twelfth year and not everywhere. All cultivars were in good health during the whole period, although the foliage of ‘Whitehouse’ exhibited minor injuries in many years. As street trees, the Callery pears were not invasive and did not yet experience branch breakage, which can become a serious problem. All of the cultivars are too tall to be planted under utility wires.


Sign in / Sign up

Export Citation Format

Share Document