scholarly journals Impact of Single Nucleotide Polymorphisms on Plasma Concentrations of Efavirenz and Lopinavir/Ritonavir in Chinese Children Infected with the Human Immunodeficiency Virus

2017 ◽  
Vol 37 (9) ◽  
pp. 1073-1080 ◽  
Author(s):  
Xia Liu ◽  
Qing Ma ◽  
Yan Zhao ◽  
Weiwei Mu ◽  
Xin Sun ◽  
...  
Keyword(s):  
Human Immunodeficiency Virus ◽  
Single Nucleotide Polymorphisms ◽  
Plasma Concentrations ◽  
Chinese Children ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Immunodeficiency Virus

scholarly journals Associations of Two Obesity-Related Single-Nucleotide Polymorphisms with Adiponectin in Chinese Children

2017 ◽  
Vol 2017 ◽  
pp. 1-5 ◽  
Author(s):  
Lijun Wu ◽  
Liwang Gao ◽  
Xiaoyuan Zhao ◽  
Meixian Zhang ◽  
Jianxin Wu ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Multiple Testing ◽  
Association Studies ◽  
Statistical Significance ◽  
Additive Model ◽  
Recessive Model ◽  
Chinese Children ◽  
Genome Wide Association Studies ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide

Purpose. Genome-wide association studies have found two obesity-related single-nucleotide polymorphisms (SNPs), rs17782313 near the melanocortin-4 receptor (MC4R) gene and rs6265 near the brain-derived neurotrophic factor (BDNF) gene, but the associations of both SNPs with other obesity-related traits are not fully described, especially in children. The aim of the present study is to investigate the associations between the SNPs and adiponectin that has a regulatory role in glucose and lipid metabolism. Methods. We examined the associations of the SNPs with adiponectin in Beijing Child and Adolescent Metabolic Syndrome (BCAMS) study. A total of 3503 children participated in the study. Results. The SNP rs6265 was significantly associated with adiponectin under an additive model (P=0.02 and 0.024, resp.) after adjustment for age, gender, and BMI or obesity statuses. The SNP rs17782313 was significantly associated with low adiponectin under a recessive model. No statistical significance was found between the two SNPs and low adiponectin after correction for multiple testing. Conclusion. We demonstrate for the first time that the SNP rs17782313 near MC4R and the SNP rs6265 near BDNF are associated with adiponectin in Chinese children. These novel findings provide important evidence that adiponectin possibly mediates MC4R and BDNF involved in obesity.

The relationship betweenInterleukin-27gene polymorphisms and Kawasaki disease in a population of Chinese children

2018 ◽  
Vol 28 (9) ◽  
pp. 1123-1128 ◽  
Author(s):  
Feifei Si ◽  
Yao Wu ◽  
Xianmin Wang ◽  
Fang Gao ◽  
Dan Yang ◽  
...  
Keyword(s):  
Kawasaki Disease ◽  
Single Nucleotide Polymorphisms ◽  
Developed Countries ◽  
Chinese Children ◽  
Interleukin 12 ◽  
Healthy Children ◽  
Arterial Aneurysm ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Interleukin 27

AbstractBackgroundKawasaki disease is the leading cause of acquired heart disease in children from developed countries. The Interleukin-6/ Interleukin-12 cytokine family has many members, including the paradoxical anti- and pro-inflammatory Interleukin-27. Recent studies have demonstrated that Interleukin-27 plays a role in immune diseases. Given this, we sought to evaluate the association betweenInterleukin-27genetic polymorphisms and Kawasaki disease in Chinese children.Methods and resultsInterleukin-27 was genotyped in 100 Kawasaki disease children and 98 healthy children (controls), resulting in the direct sequencing of eight Single-nucleotide Polymorphisms: rs17855750, rs40837, rs26528, rs428253, rs4740, rs4905, rs153109, and rs181206). There were no significant differences in Interleukin-27 genotypes between Kawasaki disease and control groups. Of the eight Single-nucleotide Polymorphisms, there was a significant increase in the risk of Kawasaki disease with coronary arterial lesions in children with the rs17855750 (T>G), rs40837 (A>G), rs4740 (G>A), rs4905 (A>G), rs153109 (T>C), and rs26528 (A>G) Single-nucleotide Polymorphisms. This was particularly true for rs17855750 (T>G), which had a greater frequency in Kawasaki disease children with coronary arterial aneurysm.ConclusionThese findings may be used as risk factors when assessing a child’s likelihood of developing Kawasaki disease, as well as for the development of future therapeutic treatments for Kawasaki disease.

246 ASSOCIATION OF SINGLE NUCLEOTIDE POLYMORPHISMS WITHIN THE BOVINE HEAT SHOCK PROTEIN 70 GENE AND CALVING RATES

2010 ◽  
Vol 22 (1) ◽  
pp. 280
Author(s):  
C. Rosenkrans Jr ◽  
M. Roe ◽  
M. Brown ◽  
Z. Johnson ◽  
H. Brown ◽  
...  
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Plasma Concentrations ◽  
Pcr Amplification ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Julian Date ◽  
Forage System ◽  
Calving Rate

Heat shock proteins (Hsp) are induced by various stressors such as heat, cold, toxins, and oxygen deprivation. Our objective was to determine the relationship among polymorphisms in the Hsp70 gene, forage system, and calving rates. Genomic DNA for 77 cows was purified from the buffy coats of EDTA-treated whole blood. The cows were Angus (n = 20), Brahman (n = 26), and reciprocal crosses (n = 31). Cows were assigned to and remained on their respective forage system for the duration of the experiment (8 years). Forage systems were endophyte-infected toxic tall fescue (E+) or common bermudagrass (CB). Specific primers for bovine Hsp70 (HSP1778F: CGCTGGAGTCGTACGCCTTC; HSP2326R: CTTGGAAGTAAACAGAAACGGG) were used for PCR amplification of a 523-base segment (based on GenBank accession number U09861). The PCR product was sequenced in both directions. Seven single nucleotide polymorphisms (SNP) were identified, and they were located at base positions 1851 (n = 6), 1902 (n = 4), 1917 (n = 4), 1926 (n =4), 2033 (n = 20), 2087 (n = 6), and 2098 (n =4). Concentrations of Hsp70, Julian date, and lifetime calving rate were analyzed by ANOVA, with each SNP represented as the main effect in the model. Two SNP resulted in altered peptide sequences, also known as mis-sense mutations (1926, aspartic acid to glutamic acid, and 2033, glycine to alanine). Five unique haplotypes were deduced based on the SNP profile (GCGCGCT, GCGCCCT, ACGCGCT, GCGCGGT, GTTGGCA, respectively, for haplotype 1, 2, 3, 4, and 5). Plasma concentrations of Hsp70 were affected by an interaction (P < 0.05) between Hsp70 haplotype and forage system. Cows with haplotypes 4 and 5 consuming fescue had higher plasma Hsp70 concentrations than other cows (5.4, 5.1, 3.8, 5.1, 5.2, 5.1, 5.7, 4.2, 22.4, and 9 MSE 1.5 ng mL-1, respectively, for 1-5 CB and 1-5 E+). That same interaction tended (P < 0.09) to be associated with lifetime calving percentage. Cows with haplotype 4 consuming bermudagrass had the lowest calving rate (58%). These results suggest that the Hsp70 gene in cattle is polymorphic, and those polymorphisms are related to cattle fertility.

scholarly journals Effects of Germline CYP2W1*6 and CYP2B6*6 Single Nucleotide Polymorphisms on Mitotane Treatment in Adrenocortical Carcinoma: A Multicenter ENSAT Study

Cancers ◽  
2020 ◽  
Vol 12 (2) ◽  
pp. 359 ◽  
Author(s):  
Barbara Altieri ◽  
Silviu Sbiera ◽  
Sabine Herterich ◽  
Silvia De Francia ◽  
Silvia Della Casa ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Therapeutic Range ◽  
Adrenocortical Carcinoma ◽  
Plasma Concentrations ◽  
Response To Therapy ◽  
Blood Levels ◽  
Individual Response ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Group B

Mitotane is the only approved drug for advanced adrenocortical carcinoma (ACC) and no biomarkers are available to predict attainment of therapeutic plasma concentrations and clinical response. Aim of the study was to evaluate the suitability of cytochrome P450(CYP)2W1 and CYP2B6 single nucleotide polymorphisms (SNPs) as biomarkers. A multicenter cohort study including 182 ACC patients (F/M = 121/61) treated with mitotane monotherapy after radical resection (group A, n = 103) or in not completely resectable, recurrent or advanced disease (group B, n = 79) was performed. CYP2W1*2, CYP2W1*6, CYP2B6*6 and CYP2B6 rs4803419 were genotyped in germline DNA. Mitotane blood levels were measured regularly. Response to therapy was evaluated as time to progression (TTP) and disease control rate (DCR). Among investigated SNPs, CYP2W1*6 and CYP2B6*6 correlated with mitotane treatment only in group B. Patients with CYP2W1*6 (n = 21) achieved less frequently therapeutic mitotane levels (>14 mg/L) than those with wild type (WT) allele (76.2% vs 51.7%, p = 0.051) and experienced shorter TTP (HR = 2.10, p = 0.019) and lower DCR (chi-square = 6.948, p = 0.008). By contrast, 55% of patients with CYP2B6*6 vs. 28.2% WT (p = 0.016) achieved therapeutic range. Combined, a higher rate of patients with CYP2W1*6WT+CYP2B6*6 (60.6%) achieved mitotane therapeutic range (p = 0.034). In not completely resectable, recurrent or advanced ACC, CYP2W1*6 SNP was associated with a reduced probability to reach mitotane therapeutic range and lower response rates, whereas CYP2B6*6 correlated with higher mitotane levels. The association of these SNPs may predict individual response to mitotane.

Sign in / Sign up

Export Citation Format

Share Document