Adipokine Gene Single-Nucleotide Polymorphisms in Portuguese Obese Adolescents: Associations with Plasma Concentrations of Adiponectin, Resistin, IL-6, IL-1β, and TNF-α

2016 ◽  
Vol 12 (4) ◽  
pp. 300-313 ◽  
Author(s):  
Henrique Nascimento ◽  
Emília Vieira ◽  
Susana Coimbra ◽  
Cristina Catarino ◽  
Elísio Costa ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Plasma Concentrations ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Obese Adolescents ◽  
Tnf Α

scholarly journals Plasma Concentration of 12-Hydroxyeicosatetraenoic Acid, Single Nucleotide Polymorphisms of 12-Lipooxygenase Gene and Vaso-Occlusion in Sickle Cell Disease

2021 ◽  
Vol 3 ◽  
Author(s):  
Augustine Nwakuche Duru ◽  
Sunday Ocheni ◽  
Obike Ibegbulam ◽  
Iheanyi Okpala
Keyword(s):  
Plasma Concentration ◽  
Sickle Cell Disease ◽  
Single Nucleotide Polymorphisms ◽  
Plasma Levels ◽  
Plasma Concentrations ◽  
Nucleotide Polymorphisms ◽  
Cell Disease ◽  
Single Nucleotide ◽  
Tnf Α ◽  
The Relationship

Background and Novel Aspect of this Work: In the light of previous findings that inflammation predisposes to intercellular adhesion and microvascular occlusion in sickle cell disease (SCD), this study investigated the relationship between the number of vaso-occlusive events in SCD, plasma levels of the pro-inflammatory molecules 12-Hydroxyeicosatetraenoic acid (12-HETE), TNF-α and IL-1β; and single nucleotide polymorphisms (SNPs) in the gene 12-Lipooxygenase (ALOX-12), which encodes the enzyme 12-Lipoxygenase that catalyzes the biosynthesis of 12-HETE.Objective: To evaluate the relationship between vaso-occlusion in SCD and plasma concentrations of 12-HETE, TNF-α, and IL-1β; and single nucleotide polymorphisms (SNPs) in ALOX-12 gene.Participants and Methods: In 50 HbSS patients, the numbers of vaso-occlusive crisis requiring hospital treatment in the previous 1 year and the vaso-occlusive complications of SCD developed to date (e.g stroke) were added to obtain the vaso-occlusive events (VOE) score. In the HbSS patients and 30 healthy sibling control persons, plasma concentrations of 12-HETE, TNF-α and IL-1β were measured by ELISA, the ALOX12 SNPs rs2073438 and rs1126667 detected by DNA sequencing, and the accrued data statistically analyzed.Results: Compared to SCD patients with VOE score 0–1, those with scores ≥3 had higher plasma levels of 12-HETE (p < 0.0001) and TNF-α (p = 0.19), but not IL-1β (p = 0.27). VOE score showed strong direct correlation with plasma level of 12-HETE (r = 0.65, p < 0.0001), but not with TNF-α nor IL-1β. Neither VOE score nor plasma concentration of 12-HETE showed any relationship with the ALOX12 SNPs rs2073438 and rs1126667.Conclusion: The strong direct correlation of VOE score with plasma concentration of 12-HETE suggests that the clinical relevance of this pro-inflammatory molecule in SCD-associated vaso-occlusion needs to be evaluated in further studies.

Single nucleotide polymorphisms of TNF-Α gene in febrile seizures

2015 ◽  
Vol 356 (1-2) ◽  
pp. 153-156 ◽  
Author(s):  
Ameneh Zare-Shahabadi ◽  
Mahmoud Reza Ashrafi ◽  
Amin Shahrokhi ◽  
Samaneh Soltani ◽  
Samaneh Zoghi ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Febrile Seizures ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Tnf Α

246 ASSOCIATION OF SINGLE NUCLEOTIDE POLYMORPHISMS WITHIN THE BOVINE HEAT SHOCK PROTEIN 70 GENE AND CALVING RATES

2010 ◽  
Vol 22 (1) ◽  
pp. 280
Author(s):  
C. Rosenkrans Jr ◽  
M. Roe ◽  
M. Brown ◽  
Z. Johnson ◽  
H. Brown ◽  
...  
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Plasma Concentrations ◽  
Pcr Amplification ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Julian Date ◽  
Forage System ◽  
Calving Rate

Heat shock proteins (Hsp) are induced by various stressors such as heat, cold, toxins, and oxygen deprivation. Our objective was to determine the relationship among polymorphisms in the Hsp70 gene, forage system, and calving rates. Genomic DNA for 77 cows was purified from the buffy coats of EDTA-treated whole blood. The cows were Angus (n = 20), Brahman (n = 26), and reciprocal crosses (n = 31). Cows were assigned to and remained on their respective forage system for the duration of the experiment (8 years). Forage systems were endophyte-infected toxic tall fescue (E+) or common bermudagrass (CB). Specific primers for bovine Hsp70 (HSP1778F: CGCTGGAGTCGTACGCCTTC; HSP2326R: CTTGGAAGTAAACAGAAACGGG) were used for PCR amplification of a 523-base segment (based on GenBank accession number U09861). The PCR product was sequenced in both directions. Seven single nucleotide polymorphisms (SNP) were identified, and they were located at base positions 1851 (n = 6), 1902 (n = 4), 1917 (n = 4), 1926 (n =4), 2033 (n = 20), 2087 (n = 6), and 2098 (n =4). Concentrations of Hsp70, Julian date, and lifetime calving rate were analyzed by ANOVA, with each SNP represented as the main effect in the model. Two SNP resulted in altered peptide sequences, also known as mis-sense mutations (1926, aspartic acid to glutamic acid, and 2033, glycine to alanine). Five unique haplotypes were deduced based on the SNP profile (GCGCGCT, GCGCCCT, ACGCGCT, GCGCGGT, GTTGGCA, respectively, for haplotype 1, 2, 3, 4, and 5). Plasma concentrations of Hsp70 were affected by an interaction (P < 0.05) between Hsp70 haplotype and forage system. Cows with haplotypes 4 and 5 consuming fescue had higher plasma Hsp70 concentrations than other cows (5.4, 5.1, 3.8, 5.1, 5.2, 5.1, 5.7, 4.2, 22.4, and 9 MSE 1.5 ng mL-1, respectively, for 1-5 CB and 1-5 E+). That same interaction tended (P < 0.09) to be associated with lifetime calving percentage. Cows with haplotype 4 consuming bermudagrass had the lowest calving rate (58%). These results suggest that the Hsp70 gene in cattle is polymorphic, and those polymorphisms are related to cattle fertility.

TNF-α promoter single nucleotide polymorphisms are markers of human ancestry

2002 ◽  
Vol 3 (8) ◽  
pp. 482-487 ◽  
Author(s):  
A Baena ◽  
J Y Leung ◽  
A D Sullivan ◽  
I Landires ◽  
N Vasquez-Luna ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Tnf Α ◽  
Human Ancestry

scholarly journals TNF-α, IL-4Rα AND IL-4 Polymorphisms in Mild to Severe Asthma from Italian Caucasians

2013 ◽  
Vol 26 (1) ◽  
pp. 75-84 ◽  
Author(s):  
F.L.M. Ricciardolo ◽  
V. Sorbello ◽  
M. Silvestri ◽  
M. Giacomelli ◽  
V.M.G. Debenedetti ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Protein Coding ◽  
Cytokine Genes ◽  
Asthmatic Patients ◽  
Tnf Α ◽  
Snp Mapping ◽  
Polymerase Chain ◽  
First Time

Asthma is a chronic airway inflammatory disease associated with airway hyperresponsiveness which affects subjects with genetic predisposition. An association has been reported between some polymorphisms in various cytokine genes and asthma. Most of them are single nucleotide polymorphisms (SNPs). These polymorphisms are detected in the protein coding sequence or in the promoter region thus influencing cytokine production. We investigated the involvement of SNP mapping in 5 cytokine genes in mild to severe asthmatics of Italian Caucasians. The frequency of alleles and genotypes, relatively to 10 allelic specificities of the cytokine genes, was defined in 57 asthmatics and in 124 control subjects by a Polymerase Chain Reaction-Sequence Specific Primer method. TNF-α -308A and TNF-α -238A allele frequencies were higher in asthmatics than in controls (p<0.001). Significant differences in the frequency of IL-4 -590T allele and of IL-4Rα + 1902A allele were also detected in asthmatics in comparison with controls (p<0.001 and p=0.005, respectively). Similarly, IL-1α -889C allele was present in 84.1% of asthmatics and in 70.2% of controls (p=0.013). Furthermore, the IL-4Rα + 1902A/A and IL-1α -889C/C homozygous conditions and the TNF-α -308G/A, TNF-α -238G/A, IL-4 -590T/C and IL-10 -1082G/A heterozygous conditions were significantly associated with asthma (p<0.05). ACA haplotype of IL-10 was observed only in asthmatic patients. This study reports, for the first time, the frequency of 10 different single nucleotide polymorphisms in 5 cytokine genes in the Italian Caucasians. Furthermore, we also indicate that in our population some single nucleotide polymorphisms are associated with mild to severe bronchial asthma.

TNF-α (−308G>A) and TNF-R1 (36A>G) single nucleotide polymorphisms are strong risk factors for odontogenic keratocystic tumor development

2017 ◽  
Vol 46 (4) ◽  
pp. 292-296 ◽  
Author(s):  
Branislav Ilic ◽  
Nadja Nikolic ◽  
Miroslav Andric ◽  
Drago Jelovac ◽  
Biljana Milicic ◽  
...  
Keyword(s):  
Risk Factors ◽  
Single Nucleotide Polymorphisms ◽  
Tumor Development ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Tnf Α
Sign in / Sign up

Export Citation Format

Share Document