Destruction of DNA-binding proteins by programmable O’PROTAC: Oligonucleotide-based PROTAC

DNA-binding proteins including transcription factors (TFs) play essential roles in gene transcription and DNA replication and repair during normal organ development and pathogenesis of diseases such as cancer, cardiovascular disease and obesity, deeming to be a large repertoire of attractive therapeutic targets. However, this group of proteins are generally considered undruggable as they lack an enzymatic catalytic site or a ligand binding pocket. PROteolysis-TArgeting Chimera (PROTAC) technology has been developed by engineering a bifunctional small molecule chimera to bring a protein of interest (POI) to the proximity of an E3 ubiquitin ligase, thus inducing the ubiquitination of POI and further degradation through proteasome pathway. Here we report the development of Oligonucleotide-based PROTAC (O’PROTACs), a class of noncanonical PROTACs in which a TF-recognizing double-stranded oligonucleotide is incorporated as a binding moiety of POI. We demonstrate that O’PROTACs of ERG and LEF1, two highly cancer-related transcription factors selectively promote degradation of these proteins and inhibit their transcriptional activity in cancer cells. The programmable nature of O’PROTACs indicates that this approach is applicable to destruct other TFs. O’PROTACs not only can serve as a research tool, but also can be harnessed as a therapeutic arsenal to target DNA binding proteins for effective treatment of diseases such as cancer.

Cationic lipid nanodisks as an siRNA delivery vehicle

The term nanodisk (ND) describes reconstituted high-density lipoprotein particles that contain one or more exogenous bioactive agents. In the present study, ND were assembled from apolipoprotein A-I, the zwitterionic glycerophospholipid 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), and the synthetic cationic lipid 1,2-dimyristoyl-3-trimethylammonium-propane (DMTAP). ND formulated at a DMPC:DMTAP ratio of 70:30 (by weight) were soluble in aqueous media. The particles generated were polydisperse, with diameters ranging from ∼20 to <50 nm. In nucleic acid binding studies, agarose gel retardation assays revealed that a synthetic 23-mer double-stranded oligonucleotide (dsOligo) bound to DMTAP containing ND but not to ND formulated with DMPC alone. Sucrose density gradient ultracentrifugation studies provided additional evidence for stable dsOligo binding to DMTAP–ND. Incubation of cultured hepatoma cells with DMTAP–ND complexed with a siRNA directed against glyceraldehyde 3-phosphate dehydrogenase showed 60% knockdown efficiency. Thus, incorporation of synthetic cationic lipid (i.e., DMTAP) to ND confers an ability to bind siRNA and the resulting complexes possess target gene knockdown activity in a cultured cell model.

Design of tetraplex specific ligands: cyclic naphthalene diimide

Cyclic naphthalene diimide 1 bound to hybrid-type tetraplex DNA from 5′-AGGG(TTAGGG)3-3′ (K = 8.6 × 106 M−1) with 260-fold greater affinity than that when binding to double stranded oligonucleotide consisting of 5′-GGG AGG TTT CGC-3′ and 3′-CCC TCC AAA GCG-5′ (nK = 3.3 × 104 M−1) with 0.5 μM of IC50 for telomerase activity.

Conjugates of Phthalocyanines with Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (⋅2−,H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence ofO2and 2-mercaptoethanol or in the presence ofH2O2. Under both sensitized and catalyzed conditions, the nucleotidesG13–G15were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.