dynamic linear range
Recently Published Documents


TOTAL DOCUMENTS

10
(FIVE YEARS 2)

H-INDEX

2
(FIVE YEARS 0)

Molecules ◽  
2022 ◽  
Vol 27 (2) ◽  
pp. 431
Author(s):  
Roghayeh Jalili ◽  
Salimeh Chenaghlou ◽  
Alireza Khataee ◽  
Balal Khalilzadeh ◽  
Mohammad-Reza Rashidi

Human Tau protein is the most reliable biomarker for the prediction of Alzheimer’s disease (AD). However, the assay to detect low concentrations of tau protein in serum is a great challenge for the early diagnosis of AD. This paper reports an electrochemiluminescence (ECL) immunosensor for Tau protein in serum samples. Gold nanostars (AuNSs) decorated on carbon nitride nanosheets (AuNS@g-CN nanostructure) show highly strong and stable ECL activity compared to pristine CN nanosheets due to the electrocatalytic and surface plasmon effects of AuNSs. As a result of the strong electromagnetic field at branches, AuNSs showed a better ECL enhancement effect than their spherical counterpart. For the fabrication of a specific immunosensor, immobilized AuNSs were functionalized with a monoclonal antibody specific for Tau protein. In the presence of Tau protein, the ECL intensity of the immunosensor decreased considerably. Under the optimal conditions, this ECL based immunosensor exhibits a dynamic linear range from 0.1 to 100 ng mL−1 with a low limit of detection of 0.034 ng mL−1. The LOD is less than the Tau level in human serum; thus, this study provides a useful method for the determination of Tau. The fabricated ECL immunosensor was successfully applied to the detection of Tau, the biomarker in serum samples. Therefore, the present approach is very promising for application in diagnosing AD within the early stages of the disease.


Processes ◽  
2021 ◽  
Vol 9 (1) ◽  
pp. 179
Author(s):  
Mawethu Pascoe Bilibana ◽  
Usisipho Feleni ◽  
Avril Rae Williams ◽  
Emmanuel Iwuoha

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.


Nanomaterials ◽  
2020 ◽  
Vol 10 (8) ◽  
pp. 1513 ◽  
Author(s):  
Venkata Narayana Palakollu ◽  
Rajshekhar Karpoormath ◽  
Lei Wang ◽  
Jiao-Ning Tang ◽  
Chen Liu

The excessive intake of chlorpromazine (CPZ) adversely affects human health profoundly, leading to a series of severe diseases such as hepatomegaly and dyskinesia. The rapid and precise detection of CPZ in real samples is of great significance for its effective surveillance. Herein, a versatile and sensitive electrochemical sensor was developed for the detection of antipsychotic drug CPZ based on a Nafion (Nf)-supported nitrogen-doped carbon dots/cuprous oxide (N-CDs/Cu2O) composite. The as-synthesized N-CDs/Cu2O composite was systematically characterized using various physicochemical techniques. The developed composite-based sensor displayed excellent performance towards CPZ determination in a dynamic linear range of 0.001–230 µM with the detection limit of 25 nM. Remarkably, the developed sensor displayed good performance in terms of sensitivity and selectivity. Furthermore, good anti-interference properties toward CPZ determination were attained despite the presence of highly concentrated interfering compounds. Therefore, this composite could be a notable potential modifier to enhance electrocatalytic activity onto the surface of the electrode. Finally, N-CDs/Cu2O/Nf-based sensor was effectively applied for quantification of CPZ in human urine and pharmaceutical formulation samples.


Toxins ◽  
2020 ◽  
Vol 12 (7) ◽  
pp. 437
Author(s):  
Sheng Huang ◽  
Jianhua Wang ◽  
Zeqin Guo ◽  
Yan Wang ◽  
Chundong Liu

Asian honeybee venom is widely used in traditional oriental medicine. Melittin is the main component of Asian honeybee venom. In the present study, an ultra-performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-QqTOF-MS) method was used for accurate qualitative and quantitative analyses of melittin in Asian honeybee venom. The results showed that the dynamic linear range of melittin was from 0.094 to 20 μg/mL, and the limit of quantification was 0.3125 μg/mL. The spiking recovery of melittin in honeybee venom ranged from 84.88% to 93.05%. Eighteen Asian honeybee venom samples in eighteen batches were collected from two different zones of China, and their melittin contents were measured. The contents of melittin in Asian honeybee venom samples was 33.9–46.23% of dry weight. This method proved a useful tool for the rapid evaluation of the authenticity and quality of Asian honeybee venom in terms of the melittin contents, and will contribute to a broader understanding of Asian honeybee venom.


2020 ◽  
pp. 174751982093096
Author(s):  
María T Moreno ◽  
Rafael Estévez Brito ◽  
Marina Córdoba ◽  
José Miguel Rodríguez Mellado

Chili peppers are rich in ascorbic acid and capsaicin. In this article is proposed an easy, fast, sensitive, and inexpensive method for determining the pungency and content of ascorbic acid in chili pepper extracts. The voltammetric (cyclic and differential pulse) behavior of capsaicin on a glassy carbon electrode has been evaluated at different pH values. A calibration curve has been obtained for the peak current, IP, of capsaicin as a function of the capsaicin concentration, C, in differential pulse voltammetry in phosphate buffer solution at pH 7.0: IP(µA) = 0.0147 (±5.346·10−3) + 0.0507 (±8.984·10−4) C(µM), with limit of detection, LOD = 0.198µM, limit of quantification, LOQ = 0.660µM, and dynamic linear range from 0.660 to 20.9 µM. A variant of the standard addition method has been used for simultaneous determination of the pungency and ascorbic acid content of extracts of Capsicum annuum cubana red. In this case, the calibration for ascorbic acid was I(µA) = 0.467 (±0.012) + 2.039·10−3 (±4.601·10−5) VAA(L)), with LOD = 17.56 µL, LOQ = 58.55 µL, and dynamic linear range from 58.6 to 500 µL, being VAA the volume of 10-mM ascorbic acid added to 50 mL of solution. The ascorbic acid content was compared to that of a sweet pepper. The method is cheap, simple, and fast (30 min vs c.a. 2 h compared to the spectrophotometric method), its sensitivity being comparable to other more expensive and/or more laborious methods.


Sensors ◽  
2018 ◽  
Vol 18 (9) ◽  
pp. 3138 ◽  
Author(s):  
Salvatore Petralia ◽  
Nunzio Vicario ◽  
Giovanna Calabrese ◽  
Rosalba Parenti ◽  
Sabrina Conoci

Surface substrate and chemical functionalization are crucial aspects for the fabrication of the sensitive biosensor based on microarray technology. In this paper, an advanced, silicon-based substrate (A-MA) allowing enhancement of optical signal for microarray application is described. The substrate consists in a multilayer of Si/Al/SiO2 layers. The optical signal enhancement is reached by a combination of the mirror effect of Al film and the SiO2 thickness around 830 nm, which is able to reach the maximum of interference for the emission wavelength of the Cy5 fluorescent label. Moreover, SiO2 layer is suitable for the immobilization of single-strand DNA through standard silane chemistry, and probe densities of about 2000 F/um2 are reached. The microarray is investigated in the detection of HBV (Hepatitis B Virus) pathogen with analytical samples, resulting in a dynamic linear range of 0.05–0.5 nM, a sensitivity of about 18000 a.u. nM−1, and a Limit of Detection in the range of 0.031–0.043 Nm as a function of the capture probe sequence.


2018 ◽  
Vol 33 (1) ◽  
pp. 57-67 ◽  
Author(s):  
Jianyu Hu ◽  
Dongyan Deng ◽  
Rui Liu ◽  
Yi Lv

Inductively coupled plasma mass spectrometry (ICPMS) has already been demonstrated as a promising technique for metallic nanoparticle tagged bioassays due to its high sensitivity, wide dynamic linear range, and more importantly multiplex and absolute quantification ability.


Nano Hybrids ◽  
2014 ◽  
Vol 6 ◽  
pp. 59-73 ◽  
Author(s):  
Unathi Sidwaba ◽  
Rachel F. Ajayi ◽  
Usisipho Feleni ◽  
Samantha Douman ◽  
Priscilla Gloria Lorraine Baker ◽  
...  

Pyrazinamine (PZA) is one of the most commonly prescribed anti-tuberculosis (anti-TB) drug due to its ability to significantly shorten the TB treatment period. However, excess PZA in the body causes hepatotoxicity and liver damage. This, therefore, calls for new methods for ensuring reliable dosing of the drug, which will differ from person to person due to interindividual differences in drug metabolism. A novel biosensor system for monitoring the metabolism of PZA was prepared with nanocomposite of multi-walled carbon nanotubes (MWCNTs), polyaniline (PANI) and cytochrome P450 3A4 (CYP3A4) electrochemically deposited on a glassy carbon electrode (GCE). The nanocomposite biosensor system exhibited enhanced electroactivity that is attributable to the catalytic effect of the incorporated MWCNTs. The biosensor had a sensitivity of 7.80 μA/μg mL-1 PZA and a dynamic linear range of 4.92 160 ng/mL PZA.


Author(s):  
Zeinab Veisi ◽  
Muhammet Ceylan ◽  
Anil Mahapatro ◽  
Ramazan Asmatulu

The presence of Cyclooxygenase-2 (COX-2) biomarker has been associated with the development of certain types of cancer such as breast cancer. Moreover, reliable quantification of COX-2 as an enzyme responsible for pain and inflammation is vital. Here we demonstrate the feasibility of sensitive COX-2 detection via integration of nanoporous polyaniline fibers on the microfabricated platform to develop a label-free biosensor. Highly porous polyaniline nanofibers were fabricated in different diameters and integrated on the interdigitated microelectrodes to develop electrochemical platforms. Characterization results revealed that the smaller diameter improved the sensitivity of the biosensor due to enhancement in the specific surface area. The developed biosensor was able to detect analyte as low as 0.1pg/mL with a large dynamic linear range of 10fg/mL to 1μg/mL. The fabricated sensor showed remarkable sensitivity towards COX-2 antigen suggesting the significant contribution of this nanofiber based platform to the enhanced sensitivity in COX-2 analyte detection.


2009 ◽  
Vol 74 (3) ◽  
pp. 311-315 ◽  
Author(s):  
Hossein Tavallali ◽  
Pisheh Jahromi

A novel optical sensor was established to determine palladium(II) based on the immobilization of 1-(2-pyridylazo)-2-naphthol (PAN) on a triacetylcellulose membrane. Palladium ions react with the immobilized PAN and cause a decrease in the absorbance of the membrane at 469 nm. The response time of the optode was 8-10 min depending on the concentration of Pd(II) ions. This sensing phase had a dynamic linear range of 0.10-12.0 ?g ml-1 palladium ions with a limit of detection of 65 ng ml-1. The sensor can readily be regenerated using an ethylenediamine solution. The sensor could be fully regenerated, and the color change was fully reversible. The method was successfully applied for the determination of Pd(II) in synthetic aqueous solutions and in a hydrogenation catalyst sample.


Sign in / Sign up

Export Citation Format

Share Document