Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome

AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

The Genetic and Clinical Features of FOXL2-Related Blepharophimosis, Ptosis and Epicanthus Inversus Syndrome

Blepharophimosis, ptosis, and epicanthus inversus syndrome (BPES) is a craniofacial disorder caused by heterozygous variants of the forkhead box L2 (FOXL2) gene. It shows autosomal dominant inheritance but can also occur sporadically. Depending on the mutation, two phenotypic subtypes have been described, both involving the same craniofacial features: type I, which is associated with premature ovarian failure (POF), and type II, which has no systemic features. The genotype–phenotype correlation is not fully understood, but it has been hypothesised that type I BPES involves more severe loss of function variants spanning the whole gene. Type II BPES has been linked to frameshift mutations that result in elongation of the protein rather than complete loss of function. A mutational hotspot has been identified within the poly-alanine domain, although the exact function of this region is still unknown. However, the BPES subtype cannot be determined genetically, necessitating informed genetic counselling and careful discussion of family planning advice in view of the associated POF particularly as the patient may still be a child. Following puberty, female patients should be referred for ovarian reserve and response assessment. Oculofacial features can be managed with surgical intervention and regular monitoring to prevent amblyopia.

FOXO1 mitigates the SMAD3/FOXL2C134W Transcriptomic Effect in a Model of Human Adult Granulosa Cell Tumor

Background: Adult granulosa cell tumor (aGCT) is a rare type of stromal cell malignant cancer of the ovary characterized by elevated estrogen levels. aGCTs ubiquitously harbor a somatic mutation in FOXL2 gene, Cys134Trp (c.402C<G); however, the general molecular effect of this mutation and its putative pathogenic role in aGCT tumorigenesis is not completely understood. We previously studied the role of FOXL2C134W, its partner SMAD3 and its antagonist FOXO1 in cellular models of aGCT. Methods: In this work, seeking more comprehensive profiling of FOXL2C134W transcriptomic effects, we performed an RNA-seq analysis comparing the effect of FOXL2WT/SMAD3 and FOXL2C143W/SMAD3 overexpression in an established human GC line (HGrC1), which is not luteinized, and bears normal alleles of FOXL2. Results: Our data shows that FOXL2C143W/SMAD3 overexpression alters the expression of 717 genes. These genes include known and novel FOXL2 targets (TGFB2, SMARCA4, HSPG2, MKI67, NFKBIA) and are enriched for neoplastic pathways (Proteoglycans in Cancer, Chromatin remodeling, Apoptosis, Tissue Morphogenesis, Tyrosine Kinase Receptors). We additionally expressed the FOXL2 antagonistic Forkhead protein, FOXO1. Surprisingly, overexpression of FOXO1 mitigated 40% of the altered genome-wide effects specifically related to FOXL2C134W, suggesting it can be a new target for aGCT treatment. Conclusions: our transcriptomic data provide novel insights into potential genes (FOXO1 regulated) that could be used as biomarkers of efficacy in aGCT patients.

FOXL2 is a Progesterone Target Gene in the Endometrium of Ruminants

Forkhead Box L2 (FOXL2) is a member of the FOXL class of transcription factors, which are essential for ovarian differentiation and function. In the endometrium, FOXL2 is also thought to be important in cattle; however, it is not clear how its expression is regulated. The maternal recognition of pregnancy signal in cattle, interferon-Tau, does not regulate FOXL2 expression. Therefore, in the present study, we examined whether the ovarian steroid hormones that orchestrate implantation regulate FOXL2 gene expression in ruminants. In sheep, we confirmed that FOXL2 mRNA and protein was expressed in the endometrium across the oestrous cycle (day 4 to day 15 post-oestrus). Similar to the bovine endometrium, ovine FOXL2 endometrial expression was low during the luteal phase of the oestrous cycle (4 to 12 days post-oestrus) and at implantation (15 days post-oestrus) while mRNA and protein expression significantly increased during the luteolytic phase (day 15 post-oestrus in cycle). In pregnant ewes, inhibition of progesterone production by trilostane during the day 5 to 16 period prevented the rise in progesterone concentrations and led to a significant increase of FOXL2 expression in caruncles compared with the control group (1.4-fold, p < 0.05). Ovariectomized ewes or cows that were supplemented with exogenous progesterone for 12 days or 6 days, respectively, had lower endometrial FOXL2 expression compared with control ovariectomized females (sheep, mRNA, 1.8-fold; protein, 2.4-fold; cattle; mRNA, 2.2-fold; p < 0.05). Exogenous oestradiol treatments for 12 days in sheep or 2 days in cattle did not affect FOXL2 endometrial expression compared with control ovariectomized females, except at the protein level in both endometrial areas in the sheep. Moreover, treating bovine endometrial explants with exogenous progesterone for 48h reduced FOXL2 expression. Using in vitro assays with COS7 cells we also demonstrated that progesterone regulates the FOXL2 promoter activity through the progesterone receptor. Collectively, our findings imply that endometrial FOXL2 is, as a direct target of progesterone, involved in early pregnancy and implantation.

A Novel FOXL2 Missense Mutation, c.1068G>C, In Chinese Families with Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome Type II

Background Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is a hereditary disease caused by a mutation in the forkhead box L2 ( FOXL2 ) gene. Female patients suffering from premature ovarian failure (POF) were classified as type I, and others were classified as type II. We aimed to clarify a novel FOXL2 indel mutation in Chinese families and to predict the POF risk in the affected patient.Methods Three generations of one Chinese family with BPES were enrolled in this study. Blood samples from patients of this family were collected and then analysed by whole-exome sequencing. Confocal microscopy was performed to observe the subcellular location. Transactivation studies were performed with real-time PCR.Results This novel mutation (c.1068G>C) is located in the downstream of DNA-binding forkhead(FHD) domain, and the mutant protein could also exhibit transactivation capacity of StAR , a key regulator of POF. Conclusively, we discovered a novel FOXL2 mutation and predicted that female patient in this family should be classified as type II BPES.Conclusions Our study revealed a novel missense mutation (c.1068G>C) and expanded the spectrum of FOXL2 gene mutations. Although we were not able to determine the classification from clinical manifestation, we discovered the patient developed type II BPES through subcellular distribution and transactivation analysis.

FOXL2 mutations in Blepharophimosis-Ptosis-Epicanthus inversus syndrome

Синдром «Блефарофимоз-птоз-обратный эпикант» (БПЭС) - заболевание, характеризующееся пороками развития век: птозом, блефарофимозом и наличием обратного эпиканта или телеканта. БПЭС у женщин может сопровождаться синдромом преж-девременного истощения яичников и связанным с ним бесплодием. В настоящей работе суммированы результаты генетического исследования 24 больных из 19 неродственных семей с направительным диагнозом БПЭС. В результате анализа всей кодирующей последовательности гена FOXL2 мутации выявлены в 10 неродственных семьях Blepharophimosis-Ptosis-Epicanthus inversus syndrome (BPES) is a disease characterized by malformations of the eyelids: ptosis, blepharophimosis and the presence of a reverse epicant or telecant (BPES). This syndrome in women can be accompanied by a premature ovarian exhaustion syndrome and related infertility. This work summarizes the results of FOXL2 gene analysis for 24 patients from 19 unrelated families with an incoming diagnosis. Mutations were detected in 10 unrelated families