Distribution of Biofilm-associated Genes among Acinetobacter baumannii by in-silico PCR

Background: Acinetobacter baumannii is a coccobacillus that is Gram negative, non motile, non fermentative and oxidase negative. It is the most common and successful nosocomial pathogen recognised by WHO. This dreadful pathogen causes urinary tract infections, ventilator associated pneumonia (VAP), bacteremia, etc., These infections are most common in hospital wards especially Intensive Care Unit (ICU). The infections are due to biofilm formation by the virulent genes of A. baumannii, and the common biofilm-associated genes of A. baumannii were bap, csuE, fimH, epsA, bfmS, ptk, pgaB, ompA, blaPER-1. Among these, bap, epsA and ompA genes are highly prevalent among the clinical strains of A. baumannii. Aim: To detect the three vital biofilm-associated genes of A. baumannii by in-silico PCR analysis. Materials and Methods: 19 isolates of A. baumannii were selected and 3 target genes, namely epsA, ompA and bap gene were used for the amplification process through in-silico PCR simulation tools. Evolutionary analysis was done for the ompA gene. Results: The epsA gene was expressed in 10.52% of the total strains selected with the highest occurrence of ompA gene as 57.89%. bap gene was not observed from the study strains included. From evolutionary analysis based on ompA distributed strains, the Acinetobacter baumannii SDF and Acinetobacter baumannii BJAB0715 might be the parental strains where the evolution of strains would have started. Through successive generations, the Acinetobacter baumannii MDR-ZJ06 and Acinetobacter baumannii TYTH-1 had become the multidrug resistant strains present in the environment. Conclusion: The findings of the study confirms the distribution of epsA and ompA genes among the 19 different strains of A. baumannii. The study suggests periodical monitoring of biofilm based virulence genes among the clinical strains and to curtail the A. baumannii infections.

Distribution of Four Biofilm Associated Gene among A. baumannii by in Silico-PCR

Background: A.baumannii is an opportunistic pathogen known for its efficient biofilm formation that is attributed for its virulence. Acinetobacter baumannii is an inhabitant of oral biofilms as well. Many gene operons are involved in the biofilm formation that need to be monitored frequently. Aim: The aim of the present study was to detect the distribution of four biofilm associated genes among A.baumannii. Materials and Methods: Four biofilm forming genes viz., bfms, ptk, pgaB, and fimH of A.baumannii were selected. Forward and reverse primers of those four genes were used for in-silico PCR amplification. 19 strains of A.baumannii set as default on the server were chosen and the amplicon bands were observed Results: The present investigation documents the distribution of four vital biofilm associated gene among 19 different strains of A.baumannii among which bfms was distributed at a higher frequency followed by pgaB and ptk Conclusion: The finding of the study suggests the presence of pgaB, bfms, ptk among the 19 different strains of A.baumannii. However further experimental validation must be done to frequently monitor the presence of the genes among the clinical strains of A.baumannii.

Detection of Drug Resistant Genes among A. baumannii by In silico PCR Method

Background: Acinetobacter baumannii is a gram-negative bacterium classified as an opportunistic pathogen in humans by the World Health Organization. Different genetic determinants contribute to multidrug resistance, and transform it as a nosocomial pathogen. Aim: Using in-silico PCR, this analysis aims to characterize the 13 distinct drug resistant genes found in 19 virulent A.baumannii strains. Materials & Methods: There were 11 A.baumannii multidrug resistance genes chosen. In-silico PCR amplification was performed using forward and reverse primers from the 11 genes described in previous research. The amplicon bands were detected in 19 strains of A.baumannii that were set as default on the server. Results: Among the 13 multidrug resistance genes studied, tet A, tet B, Sul 1, Sul 2, DfrA1, ISAba-1 and ISAba-125 were detected among the 19 virulent strains of ​A.baumannii​. Conclusion: The findings of the study documents the frequency of tet A, tet B, Sul 1, Sul 2, DfrA1, ISAba-1 and ISAba-125 like from the selected strains of A. baumannii. However, more experimental validation is needed in order to conduct routine surveillance on drug-resistant A. baumannii strains in hospital settings.

Detection of rtxA Gene as a Biomarker of Seafood-Borne Pathogen Vibrio cholerae using In Silico PCR Assay

Seafood-borne outbreaks caused by Vibrio cholerae have led to the increased need for food safety risk assessment of marine products. An in silico investigation about the potential of virulence gene of V. cholerae, rtxA, as a DNA biomarker of the toxigenic bacterium has been carried out. The aim of this study was to use the bacterial DNA biomarker sequence as a tool to facilitate early rapid detection of cholera infection. Five specific pairs of primers were designed from the rtxA open reading frame DNA of V. cholerae O1 biovar El Tor str. N16961 genomic DNA using Primer3Plus. Next, in silico Polymerase Chain Reaction (PCR) assay was carried out using the newly designed primers and 25 genomic DNA of vibrio spp. retrieved from the in silico database. One of the five designed pairs of primers, RtxAOF-RtxAOR: ‘5-CGCAAAACAGTTTCAGCCGA-3’ and 5’-AGGTTGGTCTTTTGTGGCCA-3’, could result in single DNA amplicon sized 518 bp only from V. cholerae species. No amplicon bands were produced from 17 other vibrio genomes studied using similar RtxAF-RtxAR primers. A further check showed that the amplicon was indeed part of the rtxA gene of V. cholerae. Based on this in silico study, rtxA gene appeared to be a DNA biomarker of V. cholerae, which is potential to facilitate rapid diagnosis of the virulence bacterium using in silico PCR assay.

Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.

DETECTION OF VIRULENCE GENES phoP AND phoQ IN Salmonella spp. USING IN SILICO POLYMERASE CHAIN REACTION

Detection of Salmonella bacteria based on their virulence genes is among essential steps in the eradication of clinical infection by bacteria. In this study, two pair of primers, PhoPF-PhoPR: 5’- CCGCGCAGGAAAAACTCAAA-3’ and 5’-ATCTGTTCCAGCATCACCGG -3’ as well as PhoQF-PhoQR: 5’-AGAGATGATGCGCGTACTGG-3’ and 5’- CAGACGCCCCATGAGAACAT-3’, had been successfully designed using Primer3Plus to detect the presence of phoP and phoQ genes in Salmonella spp. Using genomic DNA of 44 genomic data of Salmonella spp. as templates, PhoPF-PhoPR could produce 520-bp amplicon, while PhoQF-PhoQR could result in 598-bp amplicon. Results of in silico PCR showed that both pairs of primers PhoPF-PhoPR and PhoQF-PhoQR could detect only Salmonella enterica species, and no Salmonella bongori species could be detected based on phoP and phoQ sequences. Both pairs of PhoPF-PhoPR and PhoQF-PhoQR primers were also able to detect the virulence genes in most of the studied subspecies of Salmonella enterica available in silico database unless Arizona subspecies. As conclusion, based on this in silico study, phoP and phoQ genes appeared to be biomarkers for Salmonella enterica species. Both pairs of primers designed in this study has potential to be used as detection tool to differentiate species Salmonella enterica from Salmonella bongori, and also to distinguish S.enterica subsp. enterica from subsp. Arizonae.Keywords: Gene detection, bacterial virulence, phoP, phoQ, Salmonella spp.

Dowsing for salinity tolerance related genes in chickpea through genome wide association and in silico PCR analysis

Soil salinity is a major abiotic stress severely limits agricultural crop production throughout the world, and the stress is increasing particularly in the irrigated agricultural areas. Chickpea (Cicer arietinum L.) is an important grain legume that plays a significant role in the nutrition of the developing world. In this study, we used a chickpea subset collected from the genebank of the International Center for Agricultural Research in the Dry Area (ICARDA). This collection was selected by using the focused identification of germplasm strategy (FIGS). The subset included 138 genotypes which have been screened in the open field (Arish, Sinai, Egypt) and in the greenhouse (Giza, Egypt) by using the hydroponic system at 100 mM NaCl concentration. The experiment was laid out in randomized alpha lattice design in two replications. The molecular characterization was done by using sixteen SSR markers (collected from QTL conferred salinity tolerance in chickpea), 2,500 SNP and 3,031 DArT markers which have been developed and used for association study. The results indicated significant differences between the chickpea genotypes. Based on the average of the two hydroponic and field experiments, seven tolerant genotypes IGs (70782, 70430, 70764, 117703, 6057, 8447 and 70249) have been identified. The data analysis indicated one SSR (TAA170), three DArT (DART2393, DART769 and DART2009) and eleven SNP markers (SNP2021, SNP1268, SNP1451, SNP1487, SNP1667, SNP2095, SNP190, SNP2247 SNP1947, SNP2331 and SNP948) were associated with salinity tolerance. The flanking regions of these markers revealed genes with a known role in the salinity tolerance, which could be candidates for marker-assisted selection in chickpea breeding programs.

KASPspoon: an in vitro and in silico PCR analysis tool for high-throughput SNP genotyping

Motivation Fine mapping becomes a routine trial following quantitative trait loci (QTL) mapping studies to shrink the size of genomic segments underlying causal variants. The availability of whole genome sequences can facilitate the development of high marker density and predict gene content in genomic segments of interest. Correlations between genetic and physical positions of these loci require handling of different experimental genetic data types, and ultimately converting them into positioning markers using a routine and efficient tool. Results To convert classical QTL markers into KASP assay primers, KASPspoon simulates a PCR by running an approximate-match searching analysis on user-entered primer pairs against the provided sequences, and then comparing in vitro and in silico PCR results. KASPspoon reports amplimers close to or adjoining genes/SNPs/simple sequence repeats and those that are shared between in vitro and in silico PCR results to select the most appropriate amplimers for gene discovery. KASPspoon compares physical and genetic maps, and reports the primer set genome coverage for PCR-walking. KASPspoon could be used to design KASP assay primers to convert QTL acquired by classical molecular markers into high-throughput genotyping assays and to provide major SNP resource for the dissection of genotypic and phenotypic variation. In addition to human-readable output files, KASPspoon creates Circos configurations that illustrate different in silico and in vitro results. Availability and implementation Code available under GNU GPL at (http://www.ageri.sci.eg/index.php/facilities-services/ageri-softwares/kaspspoon). Supplementary information Supplementary data are available at Bioinformatics online.