imperfect palindrome
Recently Published Documents


TOTAL DOCUMENTS

13
(FIVE YEARS 0)

H-INDEX

7
(FIVE YEARS 0)

Microbiology ◽  
2010 ◽  
Vol 156 (2) ◽  
pp. 374-384 ◽  
Author(s):  
Stijn van der Veen ◽  
Saskia van Schalkwijk ◽  
Douwe Molenaar ◽  
Willem M. de Vos ◽  
Tjakko Abee ◽  
...  

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a ΔrecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; ΔrecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed ΔrecA mutant cells to be less resistant to heat, H2O2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.


2001 ◽  
Vol 82 (10) ◽  
pp. 2531-2547 ◽  
Author(s):  
Teresa Luque ◽  
Ruth Finch ◽  
Norman Crook ◽  
David R. O’Reilly ◽  
Doreen Winstanley

The nucleotide sequence of the DNA genome of Cydia pomonella granulovirus (CpGV) was determined and analysed. The genome is composed of 123500 bp and has a G+C content of 45·2%. It contains 143 ORFs of 150 nucleotides or more that show minimal overlap. One-hundred-and-eighteen (82·5%) of these putative genes are homologous to genes previously identified in other baculoviruses. Among them, 73 are homologous to genes of Autographa californica nucleopolyhedrovirus (AcMNPV), whereas 108 and 98 are homologous to genes of Xestia c-nigrum GV (XcGV) and Plutella xylostella GV (PxGV), respectively. These homologues show on average 37·4% overall amino acid sequence identity to those from AcMNPV and 45% to those from XcGV and PxGV. The CpGV gene content was compared to that of other baculoviruses. Several genes reported to have major roles in baculovirus biology were not found in the CpGV genome, such as gp64, the major budded virus glycoprotein gene in some nucleopolyhedroviruses, and lef-7, involved in DNA replication. However, the CpGV genome encodes the large and small subunits of ribonucleotide reductase, three inhibitor of apoptosis (iap) homologues and two protein tyrosine phosphatases. The CpGV, PxGV and XcGV genomes present a noticeably high level of conservation of gene order and orientation. A striking feature of the CpGV genome is the absence of typical homologous repeat sequences. However, it contains one major repeat region and 13 copies of a single 73–77 bp imperfect palindrome.


Genetics ◽  
2000 ◽  
Vol 154 (2) ◽  
pp. 513-522 ◽  
Author(s):  
Gareth A Cromie ◽  
Catherine B Millar ◽  
Kristina H Schmidt ◽  
David R F Leach

Abstract A 246-bp imperfect palindrome has the potential to form hairpin structures in single-stranded DNA during replication. Genetic evidence suggests that these structures are converted to double-strand breaks by the SbcCD nuclease and that the double-strand breaks are repaired by recombination. We investigated the role of a range of recombination mutations on the viability of cells containing this palindrome. The palindrome was introduced into the Escherichia coli chromosome by phage λ lysogenization. This was done in both wt and sbcC backgrounds. Repair of the SbcCD-induced double-strand breaks requires a large number of proteins, including the components of both the RecB and RecF pathways. Repair does not involve PriA-dependent replication fork restart, which suggests that the double-strand break occurs after the replication fork has passed the palindrome. In the absence of SbcCD, recombination still occurs, probably using a gap substrate. This process is also PriA independent, suggesting that there is no collapse of the replication fork. In the absence of RecA, the RecQ helicase is required for palindrome viability in a sbcC mutant, suggesting that a helicase-dependent pathway exists to allow replicative bypass of secondary structures.


1994 ◽  
Vol 14 (5) ◽  
pp. 2985-2993 ◽  
Author(s):  
M S Roberson ◽  
W E Schoderbek ◽  
G Tremml ◽  
R A Maurer

Recently, a pituitary-specific enhancer was identified within the 5' flanking region of the mouse glycoprotein hormone alpha-subunit gene. This enhancer is active in pituitary cells of the gonadotrope and thyrotrope lineages and has been designated the pituitary glycoprotein hormone basal element (PGBE). In the present studies, we sought to isolate and characterize proteins which interact with the PGBE. Mutagenesis experiments identified a 14-bp imperfect palindrome that is required for binding of a factor which is present in cells of gonadotrope and thyrotrope lineages but not in other cells. Screening of a mouse cDNA library with a DNA probe containing the imperfect palindrome resulted in the isolation of a LIM-homeodomain transcription factor. The cDNA predicts a mouse protein which is 94% identical to the recently described rat LIM-homeodomain protein LH-2. LH-2 contains two zinc fingers (LIM domain) and a consensus homeodomain. Hybridization analysis revealed relatively high expression of LH-2 mRNA in the central nervous system and in pituitary cells of the gonadotrope and thyrotrope lineages. Lower or nondetectable levels of LH-2 mRNA were found in other pituitary cells and tissues, including placental cells. Recombinant LH-2 homeodomain was found to selectively bind to the previously identified imperfect palindrome in the PGBE. Point mutations in the PGBE resulted in parallel losses in the binding of a nuclear factor from a cell line of the gonadotrope lineage and recombinant LH-2-binding activity. Use of an antibody to LH-2 provided evidence that endogenous PGBE-binding activity from cells of the gonadotrope lineage involves a protein which is immunologically related to LH-2. Expression of LH-2 in two heterologous cell types resulted in activation of a reporter gene containing the mouse alpha promoter. These data suggest that the LIM-homeodomain factor LH-2 plays a role in stimulating tissue-specific expression of the mouse glycoprotein hormone alpha subunit. The finding that a LIM-homeodomain protein can stimulate expression of one of the earliest markers of pituitary differentiation raises the possibility that this factor plays a role in cell lineage determination in the pituitary.


1994 ◽  
Vol 14 (5) ◽  
pp. 2985-2993
Author(s):  
M S Roberson ◽  
W E Schoderbek ◽  
G Tremml ◽  
R A Maurer

Recently, a pituitary-specific enhancer was identified within the 5' flanking region of the mouse glycoprotein hormone alpha-subunit gene. This enhancer is active in pituitary cells of the gonadotrope and thyrotrope lineages and has been designated the pituitary glycoprotein hormone basal element (PGBE). In the present studies, we sought to isolate and characterize proteins which interact with the PGBE. Mutagenesis experiments identified a 14-bp imperfect palindrome that is required for binding of a factor which is present in cells of gonadotrope and thyrotrope lineages but not in other cells. Screening of a mouse cDNA library with a DNA probe containing the imperfect palindrome resulted in the isolation of a LIM-homeodomain transcription factor. The cDNA predicts a mouse protein which is 94% identical to the recently described rat LIM-homeodomain protein LH-2. LH-2 contains two zinc fingers (LIM domain) and a consensus homeodomain. Hybridization analysis revealed relatively high expression of LH-2 mRNA in the central nervous system and in pituitary cells of the gonadotrope and thyrotrope lineages. Lower or nondetectable levels of LH-2 mRNA were found in other pituitary cells and tissues, including placental cells. Recombinant LH-2 homeodomain was found to selectively bind to the previously identified imperfect palindrome in the PGBE. Point mutations in the PGBE resulted in parallel losses in the binding of a nuclear factor from a cell line of the gonadotrope lineage and recombinant LH-2-binding activity. Use of an antibody to LH-2 provided evidence that endogenous PGBE-binding activity from cells of the gonadotrope lineage involves a protein which is immunologically related to LH-2. Expression of LH-2 in two heterologous cell types resulted in activation of a reporter gene containing the mouse alpha promoter. These data suggest that the LIM-homeodomain factor LH-2 plays a role in stimulating tissue-specific expression of the mouse glycoprotein hormone alpha subunit. The finding that a LIM-homeodomain protein can stimulate expression of one of the earliest markers of pituitary differentiation raises the possibility that this factor plays a role in cell lineage determination in the pituitary.


1989 ◽  
Vol 9 (2) ◽  
pp. 817-819
Author(s):  
E A Barron ◽  
Z Cao ◽  
B G Schneider ◽  
E Kraig ◽  
A J Carrillo ◽  
...  

Within the promoter region of the rat prolactin gene lies a TA-rich imperfect palindrome. The possible functions of the 18-base-pair symmetrical sequence were investigated by using an in vitro transcription system. Prolactin templates with and without the palindrome were transcriptionally assayed in both pituitary and nonpituitary extracts. Our results indicated that the palindromic sequence has at least two functions in the regulation of prolactin transcription.


1989 ◽  
Vol 9 (2) ◽  
pp. 817-819 ◽  
Author(s):  
E A Barron ◽  
Z Cao ◽  
B G Schneider ◽  
E Kraig ◽  
A J Carrillo ◽  
...  

Within the promoter region of the rat prolactin gene lies a TA-rich imperfect palindrome. The possible functions of the 18-base-pair symmetrical sequence were investigated by using an in vitro transcription system. Prolactin templates with and without the palindrome were transcriptionally assayed in both pituitary and nonpituitary extracts. Our results indicated that the palindromic sequence has at least two functions in the regulation of prolactin transcription.


1987 ◽  
Vol 7 (10) ◽  
pp. 3402-3408 ◽  
Author(s):  
Z D Cao ◽  
E A Barron ◽  
A J Carillo ◽  
Z D Sharp

We present evidence for the existence of prolactin upstream factor 1 (PUF-1) in rat pituitary-derived cells and demonstrate its interaction with a symmetrical DNA element located in the 5' flanking region of the gene. An in vitro expression system developed from pituitary-derived GH3 cells was used to determine that 420 base pairs (bp) of 5' flanking DNA was sufficient for cell-specific, accurate, and efficient RNA polymerase II transcription of the rat prolactin gene. Reconstitution of in vitro transcription with pituitary and nonpituitary nuclear extracts suggested that the presence of GH3 cell-specific factors mediated the activation of prolactin gene expression. We also demonstrated that a functionally stable transcription complex assembled on the prolactin promoter. Using DNase I protection procedures, we have identified the DNA-protein binding area in the prolactin 5' flanking region. GH3 nuclear extracts contain a cell-specific protein (PUF-I) that binds to a 28-bp region (-63 to -36)which contains an 18-bp imperfect palindrome (-63 to -46). The role that the interaction between PUF-I and the imperfect palindrome plays in in vitro pituitary-specific prolactin gene expression is discussed.


1987 ◽  
Vol 7 (10) ◽  
pp. 3402-3408
Author(s):  
Z D Cao ◽  
E A Barron ◽  
A J Carillo ◽  
Z D Sharp

We present evidence for the existence of prolactin upstream factor 1 (PUF-1) in rat pituitary-derived cells and demonstrate its interaction with a symmetrical DNA element located in the 5' flanking region of the gene. An in vitro expression system developed from pituitary-derived GH3 cells was used to determine that 420 base pairs (bp) of 5' flanking DNA was sufficient for cell-specific, accurate, and efficient RNA polymerase II transcription of the rat prolactin gene. Reconstitution of in vitro transcription with pituitary and nonpituitary nuclear extracts suggested that the presence of GH3 cell-specific factors mediated the activation of prolactin gene expression. We also demonstrated that a functionally stable transcription complex assembled on the prolactin promoter. Using DNase I protection procedures, we have identified the DNA-protein binding area in the prolactin 5' flanking region. GH3 nuclear extracts contain a cell-specific protein (PUF-I) that binds to a 28-bp region (-63 to -36)which contains an 18-bp imperfect palindrome (-63 to -46). The role that the interaction between PUF-I and the imperfect palindrome plays in in vitro pituitary-specific prolactin gene expression is discussed.


Sign in / Sign up

Export Citation Format

Share Document