mitochondrial genotype
Recently Published Documents


TOTAL DOCUMENTS

81
(FIVE YEARS 2)

H-INDEX

20
(FIVE YEARS 0)

BMC Genomics ◽  
2021 ◽  
Vol 22 (1) ◽  
Author(s):  
John C. Santiago ◽  
Joan M. Boylan ◽  
Faye A. Lemieux ◽  
Philip A. Gruppuso ◽  
Jennifer A. Sanders ◽  
...  

Abstract Background In addition to their well characterized role in cellular energy production, new evidence has revealed the involvement of mitochondria in diverse signaling pathways that regulate a broad array of cellular functions. The mitochondrial genome (mtDNA) encodes essential components of the oxidative phosphorylation (OXPHOS) pathway whose expression must be coordinated with the components transcribed from the nuclear genome. Mitochondrial dysfunction is associated with disorders including cancer and neurodegenerative diseases, yet the role of the complex interactions between the mitochondrial and nuclear genomes are poorly understood. Results Using a Drosophila model in which alternative mtDNAs are present on a common nuclear background, we studied the effects of this altered mitonuclear communication on the transcriptomic response to altered nutrient status. Adult flies with the ‘native’ and ‘disrupted’ genotypes were re-fed following brief starvation, with or without exposure to rapamycin, the cognate inhibitor of the nutrient-sensing target of rapamycin (TOR). RNAseq showed that alternative mtDNA genotypes affect the temporal transcriptional response to nutrients in a rapamycin-dependent manner. Pathways most greatly affected were OXPHOS, protein metabolism and fatty acid metabolism. A distinct set of testis-specific genes was also differentially regulated in the experiment. Conclusions Many of the differentially expressed genes between alternative mitonuclear genotypes have no direct interaction with mtDNA gene products, suggesting that the mtDNA genotype contributes to retrograde signaling from mitochondria to the nucleus. The interaction of mitochondrial genotype (mtDNA) with rapamycin treatment identifies new links between mitochondria and the nutrient-sensing mTORC1 (mechanistic target of rapamycin complex 1) signaling pathway.


Author(s):  
Amy L. Ball ◽  
Katarzyna M. Bloch ◽  
Lucille Rainbow ◽  
Xuan Liu ◽  
John Kenny ◽  
...  

AbstractMitochondrial DNA (mtDNA) is highly polymorphic and encodes 13 proteins which are critical to the production of ATP via oxidative phosphorylation. As mtDNA is maternally inherited and undergoes negligible recombination, acquired mutations have subdivided the human population into several discrete haplogroups. Mitochondrial haplogroup has been found to significantly alter mitochondrial function and impact susceptibility to adverse drug reactions. Despite these findings, there are currently limited models to assess the effect of mtDNA variation upon susceptibility to adverse drug reactions. Platelets offer a potential personalised model of this variation, as their anucleate nature offers a source of mtDNA without interference from the nuclear genome. This study, therefore, aimed to determine the effect of mtDNA variation upon mitochondrial function and drug-induced mitochondrial dysfunction in a platelet model. The mtDNA haplogroup of 383 healthy volunteers was determined using next-generation mtDNA sequencing (Illumina MiSeq). Subsequently, 30 of these volunteers from mitochondrial haplogroups H, J, T and U were recalled to donate fresh, whole blood from which platelets were isolated. Platelet mitochondrial function was tested at basal state and upon treatment with compounds associated with both mitochondrial dysfunction and adverse drug reactions, flutamide, 2-hydroxyflutamide and tolcapone (10–250 μM) using extracellular flux analysis. This study has demonstrated that freshly-isolated platelets are a practical, primary cell model, which is amenable to the study of drug-induced mitochondrial dysfunction. Specifically, platelets from donors of haplogroup J have been found to have increased susceptibility to the inhibition of complex I-driven respiration by 2-hydroxyflutamide. At a time when individual susceptibility to adverse drug reactions is not fully understood, this study provides evidence that inter-individual variation in mitochondrial genotype could be a factor in determining sensitivity to mitochondrial toxicants associated with costly adverse drug reactions.


2020 ◽  
Vol 3 (2) ◽  
pp. 48-53
Author(s):  
Hindah Sabrina Amin ◽  
Miftahul Mushlih

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.


Author(s):  
Tim Stuart ◽  
Avi Srivastava ◽  
Caleb Lareau ◽  
Rahul Satija

The recent development of experimental methods for measuring chromatin state at single-cell resolution has created a need for computational tools capable of analyzing these datasets. Here we developed Signac, a framework for the analysis of single-cell chromatin data, as an extension of the Seurat R toolkit for single-cell multimodal analysis. Signac enables an end-to-end analysis of single-cell chromatin data, including peak calling, quantification, quality control, dimension reduction, clustering, integration with single-cell gene expression datasets, DNA motif analysis, and interactive visualization. Furthermore, Signac facilitates the analysis of multimodal single-cell chromatin data, including datasets that co-assay DNA accessibility with gene expression, protein abundance, and mitochondrial genotype. We demonstrate scaling of the Signac framework to datasets containing over 700,000 cells.AvailabilityInstallation instructions, documentation, and tutorials are available at: https://satijalab.org/signac/


2019 ◽  
Vol 375 (1790) ◽  
pp. 20190174 ◽  
Author(s):  
Joseph James Dubie ◽  
Avery Robert Caraway ◽  
McKenna Margaret Stout ◽  
Vaishali Katju ◽  
Ulfar Bergthorsson

Mitochondrial genomes can sustain mutations that are simultaneously detrimental to individual fitness and yet, can proliferate within individuals owing to a replicative advantage. We analysed the fitness effects and population dynamics of a mitochondrial genome containing a novel 499 bp deletion in the cytochrome b(1) ( ctb-1 ) gene (Δ ctb-1 ) encoding the cytochrome b of complex III in Caenorhabditis elegans. Δ ctb-1 reached a high heteroplasmic frequency of 96% in one experimental line during a mutation accumulation experiment and was linked to additional spontaneous mutations in nd5 and tRNA-Asn . The Δ ctb-1 mutant mitotype imposed a significant fitness cost including a 65% and 52% reduction in productivity and competitive fitness, respectively, relative to individuals bearing wild-type (WT) mitochondria. Deletion-bearing worms were rapidly purged within a few generations when competed against WT mitochondrial DNA (mtDNA) bearing worms in experimental populations. By contrast, the Δ ctb-1 mitotype was able to persist in large populations comprising heteroplasmic individuals only, although the average intracellular frequency of Δ ctb-1 exhibited a slow decline owing to competition among individuals bearing different frequencies of the heteroplasmy. Within experimental lines subjected to severe population bottlenecks ( n = 1), the relative intracellular frequency of Δ ctb-1 increased, which is a hallmark of selfish drive. A positive correlation between Δ ctb-1 and WT mtDNA copy-number suggests a mechanism that increases total mtDNA per se , and does not discern the Δ ctb-1 mitotype from the WT mtDNA. This study demonstrates the selfish nature of the Δ ctb-1 mitotype, given its transmission advantage and substantial fitness load for the host, and highlights the importance of population size for the population dynamics of selfish mtDNA. This article is part of the theme issue ‘Linking the mitochondrial genotype to phenotype: a complex endeavour’.


2019 ◽  
Vol 375 (1790) ◽  
pp. 20190187 ◽  
Author(s):  
Anna Klucnika ◽  
Hansong Ma

The animal mitochondrial genome, although small, can have a big impact on health and disease. Non-pathogenic sequence variation among mitochondrial DNA (mtDNA) haplotypes influences traits including fertility, healthspan and lifespan, whereas pathogenic mutations are linked to incurable mitochondrial diseases and other complex conditions like ageing, diabetes, cancer and neurodegeneration. However, we know very little about how mtDNA genetic variation contributes to phenotypic differences. Infrequent recombination, the multicopy nature and nucleic acid-impenetrable membranes present significant challenges that hamper our ability to precisely map mtDNA variants responsible for traits, and to genetically modify mtDNA so that we can isolate specific mutants and characterize their biochemical and physiological consequences. Here, we summarize the past struggles and efforts in developing systems to map and edit mtDNA. We also assess the future of performing forward and reverse genetic studies on animal mitochondrial genomes. This article is part of the theme issue ‘Linking the mitochondrial genotype to phenotype: a complex endeavour’.


2019 ◽  
Vol 375 (1790) ◽  
pp. 20190181 ◽  
Author(s):  
Justin C. Havird ◽  
Alisha A. Shah ◽  
Adam J. Chicco

Mitochondria provide the vast majority of cellular energy available to eukaryotes. Therefore, adjustments in mitochondrial function through genetic changes in mitochondrial or nuclear-encoded genes might underlie environmental adaptation. Environmentally induced plasticity in mitochondrial function is also common, especially in response to thermal acclimation in aquatic systems. Here, we examined mitochondrial function in mayfly larvae ( Baetis and Drunella spp.) from high and low elevation mountain streams during thermal acclimation to ecologically relevant temperatures. A multi-substrate titration protocol was used to evaluate different respiratory states in isolated mitochondria, along with cytochrome oxidase and citrate synthase activities. In general, maximal mitochondrial respiratory capacity and oxidative phosphorylation coupling efficiency decreased during acclimation to higher temperatures, suggesting montane insects may be especially vulnerable to rapid climate change. Consistent with predictions of the climate variability hypothesis, mitochondria from Baetis collected at a low elevation site with highly variable daily and seasonal temperatures exhibited greater thermal tolerance than Baetis from a high elevation site with comparatively stable temperatures. However, mitochondrial phenotypes were more resilient than whole-organism phenotypes in the face of thermal stress. These results highlight the complex relationships between mitochondrial and organismal genotypes, phenotypes and environmental adaptation. This article is part of the theme issue ‘Linking the mitochondrial genotype to phenotype: a complex endeavour’.


2019 ◽  
Vol 375 (1790) ◽  
pp. 20190188 ◽  
Author(s):  
David M. Rand ◽  
Jim A. Mossman

The mitonuclear genome is the most successful co-evolved mutualism in the history of life on Earth. The cross-talk between the mitochondrial and nuclear genomes has been shaped by conflict and cooperation for more than 1.5 billion years, yet this system has adapted to countless genomic reorganizations by each partner, and done so under changing environments that have placed dramatic biochemical and physiological pressures on evolving lineages. From putative anaerobic origins, mitochondria emerged as the defining aerobic organelle. During this transition, the two genomes resolved rules for sex determination and transmission that made uniparental inheritance the dominant, but not a universal pattern. Mitochondria are much more than energy-producing organelles and play crucial roles in nutrient and stress signalling that can alter how nuclear genes are expressed as phenotypes. All of these interactions are examples of genotype-by-environment (GxE) interactions, gene-by-gene (GxG) interactions (epistasis) or more generally context-dependent effects on the link between genotype and phenotype. We provide evidence from our own studies in Drosophila , and from those of other systems, that mitonuclear interactions—either conflicting or cooperative—are common features of GxE and GxG. We argue that mitonuclear interactions are an important model for how to better understand the pervasive context-dependent effects underlying the architecture of complex phenotypes. Future research in this area should focus on the quantitative genetic concept of effect size to place mitochondrial links to phenotype in a proper context. This article is part of the theme issue ‘Linking the mitochondrial genotype to phenotype: a complex endeavour’.


2019 ◽  
Vol 375 (1790) ◽  
pp. 20190185 ◽  
Author(s):  
Christopher P. Wallis ◽  
Louis H. Scott ◽  
Aleksandra Filipovska ◽  
Oliver Rackham

Many conventional, modern genome engineering tools cannot be used to study mitochondrial genetics due to the unusual structure and physiology of the mitochondrial genome. Here, we review a number of newly developed, synthetic biology-based approaches for altering levels of mutant mammalian mitochondrial DNA and mitochondrial RNAs, including transcription activator-like effector nucleases, zinc finger nucleases and engineered RNA-binding proteins. These approaches allow researchers to manipulate and visualize mitochondrial processes and may provide future therapeutics. This article is part of the theme issue ‘Linking the mitochondrial genotype to phenotype: a complex endeavour’.


2019 ◽  
Vol 375 (1790) ◽  
pp. 20190173 ◽  
Author(s):  
Sarah Schaack ◽  
Eddie K. H. Ho ◽  
Fenner Macrae

Understanding and quantifying the rates of change in the mitochondrial genome is a major component of many areas of biological inquiry, from phylogenetics to human health. A critical parameter in understanding rates of change is estimating the mitochondrial mutation rate (mtDNA MR). Although the first direct estimates of mtDNA MRs were reported almost 20 years ago, the number of estimates has not grown markedly since that time. This is largely owing to the challenges associated with time- and labour-intensive mutation accumulation (MA) experiments. But even MA experiments do not solve a major problem with estimating mtDNA MRs—the challenge of disentangling the role of mutation from other evolutionary forces acting within the cell. Now that it is widely understood that any newly generated mutant allele in the mitochondria will initially be at very low frequency (1/ N , where N is the number of mtDNA molecules in the cell), the importance of understanding the effective population size ( N e ) of the mtDNA and the size of genetic bottlenecks during gametogenesis and development has come into the spotlight. In addition to these factors regulating the role of genetic drift, advances in our understanding of mitochondrial replication and turnover allow us to more easily envision how natural selection within the cell might favour or purge mutations in multi-copy organellar genomes. Here, we review the unique features of the mitochondrial genome that pose a challenge for accurate MR estimation and discuss ways to overcome those challenges. Estimates of mtDNA MRs remain one of the most widely used parameters in biology, thus accurate quantification and a deeper understanding of how and why they may vary within and between individuals, populations and species is an important goal. This article is part of the theme issue ‘Linking the mitochondrial genotype to phenotype: a complex endeavour’.


Sign in / Sign up

Export Citation Format

Share Document