A HIGHLY SENSITIVE REAL-TIME REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION FOR DETECTING NUCLEOCAPSID PROTEIN GENE OF BOTH CLASSES I AND II OF NEWCASTLE DISEASE VIRUS

Newcastle disease virus (NDV) is a worldwide viral agent that infects over 200 species of birds and is responsible for outbreaks of ND. Although a series of real-time reverse transcription polymerase chain reaction (rRT-PCR) assays have been developed for detecting different genes of NDV, diagnostic sensitivity and efficiency still can be improved. This study describes a nucleocapsid protein gene rRT-PCR screening assay based on TaqMan technology for the detection of divergent NDV strains. All 23 representative NDV strains of classes I and II in the tested panel were detected using the NP-gene rRT-PCR assay, whereas eight class I and two class II NDV isolates cannot be detected by the USDA-validated matrix-gene assay. The detection limit of the NP-gene assay was approximately 10[Formula: see text] EID[Formula: see text]/mL. The new assay also demonstrated a high degree of specificity with no false-positive results of 35 non-NDV viruses. A total of 146 clinical specimens were also tested and the NP-gene assay gave high relative sensitivity (100%) and specificity (96.61%) when compared with virus isolation. This NP-gene rRT-PCR assay offers a sensitive, specific and rapid assay for detecting both class I and II NDV and can be used alongside with the existing diagnostic assays for this notifiable disease agent.

Presence of SARS-Coronavirus-2 in sewage

In the current COVID-19 pandemic, a significant proportion of cases shed SARS-Coronavirus-2 (SARS-CoV-2) with their faeces. To determine if SARS-CoV-2 is present in sewage during the emergence of COVID-19 in the Netherlands, sewage samples of 7 cities and the airport were tested using RT-PCR against three fragments of the nucleocapsid protein gene (N1-3) and one fragment of the envelope protein gene (E). No SARS-CoV-2 was detected in samples of February 6, three weeks before the first case was reported in the Netherlands on February 27. On March 5, the N1 fragment was detected in sewage of five sites. On March 15/16, the N1 fragment was detected in sewage of six sites, and the N3 and E fragment were detected at 5 and 4 sites respectively. This is the first report of detection of SARS-CoV-2 in sewage. The detection of the virus in sewage, even when the COVID-19 prevalence is low, indicates that sewage surveillance could be a sensitive tool to monitor the circulation of the virus in the population.

First Report of Tomato chlorotic spot virus Infecting Tomatoes in Ohio

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5′-CTCGGTTTTCTGCTTTTC-3′ and JAP886, 5′CGGACAGGCTGGAGAAATCG3′) (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5′-CGTATCTGAGGATGTTGAGT-3′ and JAP888, 5′-GCTAACTCCTTGTTCTTTTG-3′). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5′-AGTATTATGCATCTATAGATTAGCACA-3′ and TCSV-R1, 5′-ACAAATCATCACATTGCCAGGA-′) were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.