Study of NTF-3 (Neurotrophic Factor 3) Gene Information in Columbidae by In Silico

Neurotrophin Factor 3 (NTF3) is one of the genes that plays an important role in the regulation of the neural systems of vertebrate animals, this gene has a special function in explaining the survival factors of some vertebrate animals. Based on the information obtained from GenBank, the nucleotide sequence of the NTF-3 gene in several vertebrate animals has been known and some of the data obtained have not been studied further for research purposes in adding information related to the molecular character of the NTF-3 gene, such as the NTF-3 gene in Columbidae. Columbidae is a group of birds that have quite diverse species variations, the number of species in columbidae will be very helpful in obtaining data on comparisons of the genetic character of the NTF3 gene. The purpose of this study was to analyze and describe the information on the NTF-3 gene (Neurotrophic Factor 3) in Columbidae through the in silico approach with computational methods. The NTF3 gene nucleotide sequences in Columbidae showed a fairly high level of similarity to the base sequences. This illustrates the fairly close proximity between each species. Geotrygon Montana is a species of Columbidae which has variations of the Base sequence which is quite different from other species. Evaluation of the model structure shows good stability of each target protein, all evaluation results describe a good structure, meaning that the conformation of each target sequence is in accordance with the sequence, so that the structure that is built has high accuracy with the actual model. The results of this research study can be a special description in explaining the genetic characteristics of several Columbidae species for the purposes of conservation measures or efforts to preserve Columbidae species at the molecular and population genetic levels.

The Evidential Statistics of Genetic Assembly: Bootstrapping a Reference Sequence

The reference sequences play an essential role in genome assembly, like type specimens in taxonomy. Those references are also samples obtained at some time and location with a specific method. How can we evaluate or discriminate uncertainties of the reference itself and assembly methods? Here we bootstrapped 50 random read data sets from a small circular genome of a Escherichia coli bacteriophage, phiX174, and tried to reconstruct the reference with 14 free assembly programs. Nine out of 14 assembly programs were capable of circular genome reconstruction. Unicycler correctly reconstructed the reference for 44 out of 50 data sets, but each reconstructed contig of the failed six data sets had minor defects. The other assembly software could reconstruct the reference with minor defects. The defect regions differed among the assembly programs, and the defect locations were far from randomly distributed in the reference genome. All contigs of Trinity included one, but Minia had two perfect copies other than an imperfect reference copy. The centroid of contigs for assembly programs except Unicycler differed from the reference with 75bases at most. Nonmetric multidimensional scaling (NMDS) plots of the centroids indicated that even the reference sequence was located slightly off from the estimated location of the true reference. We propose that the combination of bootstrapping a reference, making consensus contigs as centroids in an edit distance, and NMDS plotting will provide an evidential statistic way of genetic assembly for non-fragmented base sequences.

Primer Design and Analysis for Detection of mecA gene

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method

Working with DNA sequences and other character data.

This chapter describes the use of an internet-based statistical analysis (R) for manipulating nucleotide sequences such as reverse-complementing and complementing, translating DNA to RNA and converting base sequences to amino acids. A few examples that introduce some more useful R functions are also included.

Working with DNA sequences and other character data.

This chapter describes the use of an internet-based statistical analysis (R) for manipulating nucleotide sequences such as reverse-complementing and complementing, translating DNA to RNA and converting base sequences to amino acids. A few examples that introduce some more useful R functions are also included.

α-Arylation of (hetero)aryl ketones in aqueous surfactant media

α-Arylations can be run under micellar catalysis conditions using a Pd(i) pre-catalyst together with KO-t-Bu as base. Sequences using this coupling along with as many as four additional steps can be carried out in a 1-pot fashion, all in water.

Possible contribution of trained immunity in faulty hormonal imprinting and DOHaD: Review and hypothesis

The faulty hormonal imprinting theory (published in 1980) and the DOHaD (Developmental Origin of Health and Disease theory (published in 1986) are twin-concepts: both justify the manifestation after long time (in adults) diseases which had been provoked in differentiating cells (e.g. during gestation). This was demonstrated using animal experiments as well, as comparative statistical methods (in human cases). However, there is no explanation for the tools of memorization (even after decades) of the early adversity and the tools of execution (manifestation) in adult age. It seems likely that immune memory is involved to the memorization of early adversity, up to the manifestation of the result (non-communicable diseases). Nevertheless, the relatively short timespan of adaptive immune memory makes this system insuitable for this function, however the newly recognized trained memory of the innate immune system seems to be theoretically suitable for the storage of the records and handling the sequalae, which is the epigenetic reprogramming in the time of provocation, without changes in base sequences (mutation). The flawed (damaged) program is manifested later, in adult age. Evidences are incomplete, so further animal experiments and human observations are needed for justifying the theory.

Phylogenetic Analysis of Streptomyces spp. Isolated from Soil Samples in Sulaimani Governorate

Streptomyces species have been an important source of bioactive secondary metabolites and clinically useful for antibiotic production, including fosfomycin, daptomycin, oxytetracycline, streptomycin, and chloramphenicol. The main objective of this study was to isolate actinomycetes, especially Streptomyces from 8 soil samples that collected from two different places, which are districts in Sulaimani governorate, Kurdistan Region of Iraq. Totally, 30 diagnostic tests were carried out for representative of isolated Streptomyces depending on the color groups. The 16Sr DNA gene was sequenced, for ten isolated test strains were amplified with 2 universal primers after extraction of genomic DNA, only 8 of them were successfully sequenced. Phylogenetic analysis of 8 test strains carried out using base sequences of 16Sr DNA genes in the core genome. Four of isolated test strains were identified as a Streptomyces fulvissimus, and others were nominated as a Streptomyces anulatus. The obtained sequence data were compared with the sequence data of the closest related species in the international databases using EzTaxon Server program and (%) similarities were determined. Finally, phylogenetic analysis indicated that isolated test strains were nominated as (H001, H002, H003, and H004), which recognized members of the S. anulatus and the similarity with their type strain is 99.93%. Whereas, other four isolated test strains, including D001, D002, D003, and D004 recognized as members of the S. fulvissimus and similarity with their type strain is 100%.

Simulation of Chordate Intron Evolution Using Randomly Generated and Mutated Base Sequences

Introns are well known for their high variation not only in length but also in base sequence. The evolution of intron sequences has aroused broad interest in the past decades. However, very little is known about the evolutionary pattern of introns due to the lack of efficient analytical method. In this study, we designed 2 evolutionary models, that is, mutation-and-deletion (MD) and mutation-and-insertion (MI), to simulate intron evolution using randomly generated and mutated bases by referencing to the phylogenetic tree constructed using 14 chordate introns from TF4 (transcription factor–like protein 4) gene. A comparison of attributes between model-generated sequences and chordate introns showed that the MD model with proper parameter settings could generate sequences that have attributes matchable to chordate introns, whereas the MI model with any parameter settings failed in doing so. These data suggest that the surveyed chordate introns have evolved from a long ancestral sequence through gradual reduction in length. The established methodology provides an effective measure to study the evolutionary pattern of intron sequences from organisms of various taxonomic groups. (C++ scripts of MD and MI models are available upon request.)