Endoscopic removal of recurrent colloid cysts

OBJECTIVERemoval of colloid cysts of the third ventricle using a purely endoscopic method has been established as a safe and advantageous technique. It is hypothesized that endoscopic removal in recurrent cases might pose more technical challenges and result in less success. The objective of this study was to assess the feasibility and outcomes of using a purely endoscopic approach for the management of recurrent colloid cysts compared to primary cysts.METHODSA retrospective cohort study was performed on patients who underwent purely endoscopic removal of their colloid cyst. Descriptive statistics were compared for patients undergoing surgery for a recurrent cyst and those for a control cohort undergoing surgery for a primary cyst. Bivariate analysis was conducted using a Fisher’s exact test for categorical variables and Mann-Whitney U-test for continuous variables.RESULTSIn total, 121 patients had a primary colloid cyst endoscopically removed and 10 patients had a total of 11 recurrent cysts removed. Recurrence or progression after surgery occurred in 3 (2.5%) cases in the primary cyst group and 2 (18.2%) cases in the recurrent cyst group. Symptomatic presentation during the follow-up period occurred in 6 (54.5%) cases in the recurrent cyst group versus 75 (62%) cases in the primary cyst group (p = 0.749). Two patients (20%) in the recurrent group had a second recurrence in a mean period of 30 months (1 patient at 15 and 1 patient at 45 months). One of these patients required a tertiary endoscopic removal 8 years after the second resection. No immediate postoperative complications or new morbidities were observed after repeat endoscopic surgery. The authors’ findings indicated a nonsignificant trend toward a higher recurrence rate (18.2% vs 2.5%, p = 0.055) and a decreased proportion of complete removal (90.9% vs 81.8%, p = 0.296) in the recurrent cyst group compared to the primary cyst group. However, a significantly higher rate of preoperative hydrocephalus was observed in the primary cyst group compared with the recurrent cyst group (63.6% vs 18.2%, p = 0.007).CONCLUSIONSPurely endoscopic approaches for the removal of recurrent colloid cysts of the third ventricle are feasible and equally safe compared with endoscopic removal of primary cysts. The study’s findings did not show a statistically significant difference in the rate of recurrence between the 2 groups. The proportion of patients with symptomatic cysts on presentation was lower in patients with recurrent cysts than in patients with primary cysts. Due to the high rate of complete removal with negligible morbidity, the authors continue to advocate for an endoscopic removal at the time of cyst recurrence.

Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response

The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role in intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test, follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.

Extreme intraneural ganglion cysts

Object The mechanism responsible for exceptional examples of intraneural ganglia with extensive longitudinal involvement has not been understood. Such cases of intraneural cysts, seemingly remote from a joint, have been thought not to have articular connections. Decompression and attempted resection of the cyst has led to intraneural recurrence and poor neurological recovery. The purpose of this report is not only to clarify the pathogenesis of these cysts, but also to discuss their treatment based on modern concepts of intraneural ganglia. Methods Two examples of extreme longitudinal propagation of intraneural ganglia are presented. Results A patient with a moderate tibial neuropathy was found to have a tibial intraneural ganglion. Prospective interpretation of the MR imaging study demonstrated the cyst's origin from the posterior portion of the superior tibiofibular joint (STFJ), with proximal extension within the sciatic nerve to the lower buttock region. Communication between the STFJ and the cyst was confirmed with direct knee MR arthrography. The tibial intraneural cyst was treated successfully by a relatively limited exposure in the distal popliteal fossa: the cyst was decompressed, the articular branch disconnected, and the STFJ resected. Postoperatively, the patient improved neurologically and there was no evidence of recurrent cyst on postoperative MR imaging. A second patient, previously reported by another group, was reexamined 22 years after surgery. This patient had an extensive peroneal intraneural ganglion that extended into the sciatic nerve from the knee to the buttock; no joint connection or recurrent cyst had initially been described. In this patient, the authors hypothesized and established with MR imaging the presence of both: a joint connection to the anterior portion of the STFJ from the peroneal articular branch as well as recurrent cyst within the peroneal and tibial nerves. Conclusions This paper demonstrates that extreme intraneural cysts are not clinical outliers but represent extreme examples of other more typical intraneural cysts. They logically obey the same principles, previously described in the unified articular (synovial) theory. The degree of longitudinal extension is probably due to high intraarticular pressures within the degenerative joint of origin. The generalizability of the mechanistic principles is highlighted by the fact that these 2 cases, involving the tibial and the peroneal nerve respectively, both extended well distant (that is, to the buttock) from the STFJ via their respective articular branch of origin. These extensive intraneural cysts can be treated successfully by disconnecting the affected articular branch and by resection of the joint of origin, rather than by a more aggressive operation resecting the cyst and cyst wall.

A critical appraisal of syrinx cavity shunting procedures

Object. This study was conducted to evaluate the results of shunting procedures for syringomyelia. Methods. In a follow-up analysis of 42 patients in whom shunts were placed in syringomyelic cavities, the authors have demonstrated that 21 (50%) developed recurrent cyst expansion indicative of shunt failure. Problems were encountered in patients with syringomyelia resulting from hindbrain herniation, spinal trauma, or inflammatory processes. A low-pressure cerebrospinal fluid state occurred in two of 18 patients; infection was also rare (one of 18 patients), but both are potentially devastating complications of shunt procedures. Shunt obstruction, the most common problem, was encountered in 18 patients; spinal cord tethering, seen in three cases, may account for situations in which the patient gradually deteriorated neurologically, despite a functioning shunt. Conclusions. Placement of all types of shunts (subarachnoid, syringoperitoneal, and syringopleural) may be followed by significant morbidity requiring one or more additional surgical procedures.

Long-term control of recurrent cyst of the conus medullaris

✓ The authors report a case in which decompression of an intramedullary epidermoid cyst was maintained by intermittent drainage via an implanted subcutaneous Ommaya reservoir.