transcription sites
Recently Published Documents


TOTAL DOCUMENTS

115
(FIVE YEARS 7)

H-INDEX

35
(FIVE YEARS 0)

2022 ◽  
Author(s):  
Alejandro Fonseca ◽  
Tomas C. Moyano ◽  
Stefanie Rosa ◽  
Rodrigo A Gutiérrez

Nitrate is a signaling molecule that regulates gene expression in plants. The nitrate response has been extensively characterized at the transcriptome level. However, we know little about RNA nucleocytoplasmic dynamics during nitrate response. To understand the role of mRNA localization during the nitrate response, we isolated mRNA from the nucleus, cytoplasm, and whole-cells from nitrate-treated Arabidopsis roots and performed RNA-seq. We identified 402 differentially localized transcripts (DLTs) in response to nitrate. DLTs were enriched in GO-terms related to metabolism, response to stimulus, and transport. DLTs showed five localization patterns: nuclear reduction, cytoplasmic reduction, nuclear accumulation, cytoplasmic accumulation, or delayed-cytoplasmic accumulation in response to nitrate. DLTs exhibited large changes in RNA polymerase II occupancy of cognate genes and high mRNA turnover rates, indicating these are rapidly replaced mRNAs. The NITRATE REDUCTASE 1 (NIA1) transcript exhibited the largest changes in synthesis and decay. Using single-molecule RNA FISH, we showed that NIA1 nuclear accumulation occurs mainly at transcription sites. The decay profiles for NIA1 showed a higher half-life when the transcript accumulated in the nucleus than in the cytoplasm. We propose that regulating nucleocytoplasmic mRNA distribution allows tuning transcript availability of fastly replaced mRNAs, controlling plants' adaptive response to nitrogen nutrient signals.


2021 ◽  
Vol 221 (2) ◽  
Author(s):  
Satoshi Uchino ◽  
Yuma Ito ◽  
Yuko Sato ◽  
Tetsuya Handa ◽  
Yasuyuki Ohkawa ◽  
...  

In eukaryotic nuclei, most genes are transcribed by RNA polymerase II (RNAP2), whose regulation is a key to understanding the genome and cell function. RNAP2 has a long heptapeptide repeat (Tyr1-Ser2-Pro3-Thr4-Ser5-Pro6-Ser7), and Ser2 is phosphorylated on an elongation form. To detect RNAP2 Ser2 phosphorylation (RNAP2 Ser2ph) in living cells, we developed a genetically encoded modification-specific intracellular antibody (mintbody) probe. The RNAP2 Ser2ph-mintbody exhibited numerous foci, possibly representing transcription “factories,” and foci were diminished during mitosis and in a Ser2 kinase inhibitor. An in vitro binding assay using phosphopeptides confirmed the mintbody’s specificity. RNAP2 Ser2ph-mintbody foci were colocalized with proteins associated with elongating RNAP2 compared with factors involved in the initiation. These results support the view that mintbody localization represents the sites of RNAP2 Ser2ph in living cells. RNAP2 Ser2ph-mintbody foci showed constrained diffusional motion like chromatin, but they were more mobile than DNA replication domains and p300-enriched foci, suggesting that the elongating RNAP2 complexes are separated from more confined chromatin domains.


2021 ◽  
Author(s):  
Albert Tsai ◽  
Justin Crocker

An embryo experiences progressively complex spatial and temporal patterns of gene expression that guide the morphogenesis of its body plan as it matures. Using super-resolution fluorescence microscopy in Drosophila melanogaster embryos, we observed a similar increase in complexity in the nucleus: the spatial distributions of transcription factors became increasingly heterogeneous as the embryo matured. We also observed a similar trend in chromatin conformation with the establishment of specific histone modification patterns. However, transcription sites of specific genes had distinct local preferences for histone marks separate from the average nuclear trend, depending on the time and location of their expression. These results suggest that reconfiguring the nuclear environment is an integral part of embryogenesis and that the physical organization of the nucleus a key element in developmental gene regulation.


2021 ◽  
Vol 9 (A) ◽  
pp. 455-462
Author(s):  
Sinta Murlistyarini ◽  
Teguh Wahju Sardjono ◽  
Lukman Hakim ◽  
Sri Widyarti ◽  
Didik Huswo Utomo ◽  
...  

BACKGROUND: Cellular senescence is known to be correlated with the cessation of cell cycle. The progression of cell cycle is promoted by activities of various proteins, including cyclin-dependent kinase (CDK) and cyclin proteins, which work synergistically. CDK-cyclin complexes are influenced by other proteins, such as retinoblastoma (Rb) and E2F proteins. In cell cycle, both Rb and E2F proteins could be affected by one of the CDK inhibitors, that is, p21. MicroRNA (miRNA) is well known for its role in biological processes, including cell cycle. However, the contribution of miRNA in cell cycle is still poorly understood. Some miRNAs play a role in pro-proliferation and anti-proliferation. AIM: This study was performed an in silico study analysis to reveal the relationship between miRNA-17-5p and p21 in the process of cellular senescence. METHODS: The extensive data mining was conducted to determine the miRNA that contributes to the process of anti-aging prevention and the desired target genes through the Human Protein Atlas and cancer database. miRNA target prediction was performed using DIANA-microT-CDS. Gene function of the miRNA-17-5p target was annotated using DAVID GO. RESULTS: The sequence of hsa-miRNA-17-5p (CAAAGUGCUUACAGUGCAGGUAG) has three attachment sites with binding types of 8 mer, 6 mer, and 8 mer at the transcription sites of 447–474, 485–513, and 1132–1154, respectively. The main profile of hsa-miRNA-17-5p showed that it bound to 3’-untranslated region and the coding region (exon). CONCLUSIONS: The miRNA-17-5p was involved in cellular senescence by influencing the process of cell proliferation in the cell cycle pathway.


2021 ◽  
Author(s):  
Shari Carmon ◽  
Felix Jonas ◽  
Naama Barkai ◽  
Eyal D Schejter ◽  
Ben-Zion Shilo

Morphogen gradients are known to subdivide a naïve cell field into distinct zones of gene expression. Here we examine whether morphogens can also induce a graded response within such domains. To this end we explore the role of the Dorsal protein nuclear gradient along the dorso-ventral axis in defining the graded pattern of actomyosin constriction that initiates gastrulation in early Drosophila embryos. Two complementary mechanisms for graded accumulation of mRNAs of critical zygotic target genes were identified. First, activation of target-gene expression expands over time from the ventral-most region of high nuclear Dorsal to lateral regions where the levels are lower, due to a Dorsal-dependent priming probability of transcription sites. Thus, sites that are activated earlier will lead to more mRNA accumulation. Second, once the sites are primed, the rate of Pol II loading is also dependent on Dorsal levels. Morphological restrictions require that translation of the graded mRNA be delayed until completion of embryonic cell formation. Such timing is achieved by large introns, that provide a delay in production of the mature mRNAs.


2021 ◽  
Author(s):  
Satoshi Uchino ◽  
Yuma Ito ◽  
Yuko Sato ◽  
Tetsuya Handa ◽  
Yasuyuki Ohkawa ◽  
...  

AbstractIn eukaryotic nuclei, most genes are transcribed by RNA polymerase II (RNAP2). How RNAP2 transcription is regulated in the nucleus is a key to understanding the genome and cell function. The largest subunit of RNAP2 has a long heptapeptide repeat (Tyr1-Ser2-Pro3-Thr4-Ser5- Pro6-Ser7) at the C-terminal domain and Ser2 is phosphorylated on an elongation form of RNAP2. To detect RNAP2 Ser2 phosphorylation (RNAP2 Ser2ph) in living cells, we developed a genetically encoded modification-specific intracellular antibody (mintbody) probe. The RNAP2 Ser2ph-mintbody probe exhibited numerous foci, possibly representing transcription “factories” in living HeLa cells, and foci were diminished when cells were treated with triptolide to induce RNAP2 degradation and with flavopiridol to inhibit Ser2ph. An in vitro binding assay using phospho-peptides confirmed the Ser2ph-specific binding of the mintbody. These results support the view that mintbody localization represents the sites of RNAP2 Ser2ph in living cells. RNAP2 Ser2ph-mintbody foci were colocalized with proteins associated with elongating RNAP2, such as the CDK12 and Paf1 complex component, compared to factors involved in transcription activation around the transcription start sites, such as CDK9 and BRD4. Tracking analysis revealed that RNAP2 Ser2ph-mintbody foci showed constrained diffusional motion like chromatin, but was more mobile compared to euchromatin domains, suggesting that the elongating RNAP2 complexes are separated from the more confined initiating clusters.SummaryThe authors developed a genetically encoded probe to specifically detect the Ser2- phosphorylated, elongating form of RNA Polymerase II in living cells. The motion of Ser2- phosphorylated polymerase foci was more dynamic than chromatin domains, suggesting that the elongating complexes are separated from the more confined initiating clusters.


2021 ◽  
Vol 28 ◽  
Author(s):  
Hiroaki Tachiwana ◽  
Noriko Saitoh

Background: Transcriptome analyses have revealed the presence of numerous long non-coding RNAs (lncRNAs) in mammalian cells. Many lncRNAs are expressed in development-, differentiation-, and disease-specific manners, suggesting their importance as cell regulators. Some nuclear lncRNAs are bound to specific genomic loci, either near or distant from their own transcription sites, and regulate gene expression in cis or trans. These lncRNAs recruit epigenetic factors, including the DNA methyl transferase and histone modification complex, and mediate both the 3D genome structure and nuclear domains. LncRNAs are now considered as an emerging member of epigenetic regulators. LncRNAs are dysregulated in various types of cancer, and act as either oncogenic or tumor-suppressing factors. They are involved in virtually all of the cancer hallmarks, and are potential diagnostic markers and therapeutic targets. Objective: In this review, we describe several representative lncRNAs and provide a current overview of the mechanisms by which lncRNAs participate in epigenetic regulation and contribute to cancer development.


2020 ◽  
Vol 11 (1) ◽  
Author(s):  
Katla Kristjánsdóttir ◽  
Alexis Dziubek ◽  
Hyun Min Kang ◽  
Hojoong Kwak

AbstractEnhancer RNAs (eRNA) are unstable non-coding RNAs, transcribed bidirectionally from active regulatory sequences, whose expression levels correlate with enhancer activity. We use capped-nascent-RNA sequencing to efficiently capture bidirectional transcription initiation across several human lymphoblastoid cell lines (Yoruba population) and detect ~75,000 eRNA transcription sites with high sensitivity and specificity. The use of nascent-RNA sequencing sidesteps the confounding effect of eRNA instability. We identify quantitative trait loci (QTLs) associated with the level and directionality of eRNA expression. High-resolution analyses of these two types of QTLs reveal distinct positions of enrichment at the central transcription factor (TF) binding regions and at the flanking eRNA initiation regions, both of which are associated with mRNA expression QTLs. These two regions—the central TF-binding footprint and the eRNA initiation cores—define a bipartite architecture of enhancers, inform enhancer function, and can be used as an indicator of the significance of non-coding regulatory variants.


2020 ◽  
Vol 117 (43) ◽  
pp. 26812-26821
Author(s):  
Sarah Robinson-Thiewes ◽  
John McCloskey ◽  
Judith Kimble

The expression of genes encoding powerful developmental regulators is exquisitely controlled, often at multiple levels. Here, we investigate developmental expression of three conserved genes, Caenorhabditis elegans mpk-1, lag-1, and lag-3/sel-8, which encode homologs of ERK/MAPK and core components of the Notch-dependent transcription complex, respectively. We use single-molecule FISH (smFISH) and MATLAB to visualize and quantify nuclear nascent transcripts and cytoplasmic mRNAs as a function of position along the germline developmental axis. Using differentially labeled probes, one spanning an exceptionally long first intron and the other spanning exons, we identify two classes of active transcription sites (ATS). The iATS class, for “incomplete” ATS, harbors only partial nascent transcripts; the cATS class, for “complete” ATS, harbors full-length nascent transcripts. Remarkably, the frequencies of iATS and cATS are patterned along the germline axis. For example, most mpk-1 ATS are iATS in hermaphrodite germline stem cells, but most are cATS in differentiating stem cell daughters. Thus, mpk-1 ATS class frequencies switch in a graded manner as stem cell daughters begin differentiation. Importantly, the patterns of ATS class frequency are gene-, stage-, and sex-specific, and cATS frequency strongly correlates with transcriptional output. Although the molecular mechanism underlying ATS classes is not understood, their primary difference is the extent of transcriptional progression. To generate only partial nascent transcripts in iATS, progression must be slowed, paused, or aborted midway through the gene. We propose that regulation of ATS class can be a critical mode of developmental gene regulation.


2020 ◽  
Author(s):  
Sarah Robinson-Thiewes ◽  
John McCloskey ◽  
Judith Kimble

AbstractGenes encoding powerful developmental regulators are exquisitely controlled, often at multiple levels. Here, we use single molecule FISH (smFISH) to investigate nuclear active transcription sites (ATS) and cytoplasmic mRNAs of three key regulatory genes along the C. elegans germline developmental axis. The genes encode ERK/MAP kinase and core components of the Notch-dependent transcription complex. Using differentially-labeled probes spanning either a long first intron or downstream exons, we identify two ATS classes that differ in transcriptional progression: iATS harbor partial nascent transcripts while cATS harbor full-length nascent transcripts. Remarkably, the frequencies of iATS and cATS are patterned along the germline axis in a gene-, stage- and sex-specific manner. Moreover, regions with more frequent iATS make fewer full-length nascent transcripts and mRNAs, whereas those with more frequent cATS produce more of them. We propose that the regulated balance of these two ATS classes has a major impact on transcriptional output during development.


Sign in / Sign up

Export Citation Format

Share Document