Identification of microRNA-like RNAs from Trichoderma asperellum DQ-1 during its interaction with tomato roots using bioinformatic analysis and high-throughput sequencing

MicroRNA-like small RNAs (milRNAs) and their regulatory roles in the interaction between plant and fungus have recently aroused keen interest of plant pathologists. Trichoderma spp., one of the widespread biocontrol fungi, can promote plant growth and induce plant disease resistance. To investigate milRNAs potentially involved in the interaction between Trichoderma and tomato roots, a small RNA (sRNA) library expressed during the interaction of T. asperellum DQ-1 and tomato roots was constructed and sequenced using the Illumina HiSeqTM 2500 sequencing platform. From 13,464,142 sRNA reads, we identified 21 milRNA candidates that were similar to other known microRNAs in the miRBase database and 22 novel milRNA candidates that possessed a stable microRNA precursor hairpin structure. Among them, three milRNA candidates showed different expression level in the interaction according to the result of stem-loop RT-PCR indicating that these milRNAs may play a distinct regulatory role in the interaction between Trichoderma and tomato roots. The potential transboundary milRNAs from T. asperellum and their target genes in tomato were predicted by bioinformatics analysis. The results revealed that several interesting proteins involved in plant growth and development, disease resistance, seed maturation, and osmotic stress signal transduction might be regulated by the transboundary milRNAs. To our knowledge, this is the first report of milRNAs taking part in the process of interaction of T. asperellum and tomato roots and associated with plant promotion and disease resistance. The results might be useful to unravel the mechanism of interaction between Trichoderma and tomato.

Occurrence of Chenopodium quinoa mitovirus 1 in Chenopodium quinoa in China

Chenopodium quinoa mitovirus 1 (CqMV1), a member of Mitovirus in the family Mitoviridae, is the first identified plant mitovirus (Nerva et al., 2019), which has been reported to be capable of infecting different cultivars of Chenopodium quinoa including Cherry vanilla quinoa, GQU-7356 campesino Quinoa, and Wild (Nerva et al., 2019). Cultivation of C. quinoa has increased notably in China, with good agricultural and industrial results due to its nutritional value (Vega-Gálvez et al., 2010). In September 2019, leaf mottling and plant stunting were observed on C. quinoa (cv. Longli 1) plants (Fig. S1) in a field of about 0.9 acre in Qingyuan County, Zhejiang Province, China. About 33.3% (401/1200) of C. quinoa showed leaf mottling and plant stunting symptoms. To identify viral agents potentially associated with this disease, a sRNA library from a symptomatic leaf sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and the library was constructed using the Truseq Small RNA Library preparation kit (Illumina, CA, USA). Approximately 14 million raw reads were obtained from the Illumina MiSeq platform. The clean reads were obtained and assembled using the VirusDetect pipeline v1.6 (Zheng et al., 2017) for virus identification. A total of 22 assembled contigs, with sizes ranging from 42 to 306 nt, could be aligned to the genome of CqMV1 isolate Che1 (accession no. MF375475) with nucleotide identities of 96.3% to 99.1% and a cumulative alignment coverage of the CqMV1 genome of 84.0%. Except for CqMV1, no other viruses or viroids were found in the sample. Based on the assembled contigs and the reference CqMV1 genome, we designed two primer pairs (P1F: 5′- TCCGAATCTCATTTTCGGAGTGGGTAGA -3′ and P1R: 5′- CAGACTTTAGATCAAATGAATACACATGT -3′; P2F: 5′- TCCAGTATACCTGTGGATAGTACTTTCA -3′and P2R: 5′- CGATCTCTGCTACCAAATACTCGTGAGCC -3′) to obtain the genome sequence of CqMV1 isolate Zhejiang (CqMV1-ZJ). Total RNA from the CqMV1-infected C. quinoa plant was subject to reverse transcription (RT) using AMV reverse transcriptase (TaKaRa, Tokyo, Japan) with random primers N6 (TaKaRa, Tokyo, Japan). The cDNA was then used as the template to amplify two regions in the genome, which together covered the entire genome of CqMV1-ZJ, using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). The PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced (YouKang Co., Ltd, China). The obtained sequences were assembled into a 2,730-nt contig, representing the complete genome of CqMV1-ZJ (GenBank accession no. MT089917). Pairwise sequence comparison using the Sequence Demarcation Tool v.1.2 (Muhire et al., 2014) revealed that CqMV1-ZJ shared a sequence identity of 96.9% with the sole CqMV1 sequence available in GenBank (MF375475), thus confirming the identity of the virus as CqMV1. Furthermore, we performed RT- PCR detection on 10 collected samples using the primer pair P1F and P1R. All seven symptomatic plants tested positive for CqMV1 infection, whereas three asymptomatic plants were CqMV1-free (Fig. S1), suggesting a possible association between the virus and the symptoms observed. However, in the study by Nerva et al, two CqMV1 infected accessions (cv. Regalona and IPSP1) were found asymptomatic (Nerva et al., 2019), we therefore speculated that the symptom caused by CqMV1 varies between different C. quinoa varieties or its growth environment. To the best of our knowledge, this is the first report of CqMV1 infecting C. quinoa in China. Its ability to be transmitted through seeds (Nerva et al., 2019) and the possible pathogenicity in C. quinoa raises a serious concern for the local C. quinoa industry. The findings reported here will assist further investigations on the epidemiology and biological characteristics of CqMV1 in Zhejiang, China.

Identification and characterization of salt-tolerance relative miRNAs in Procambarus clarkii by high-throughput sequencing

Procambarus clarkii is one of the important economic species in China and has been served as tasty food in recent years after being introduced to Nanjing. Significant problems of environment factors, such as salinity, pH and temperature, especially salinity, has the potential to result in significant economic losses in many crayfish-producing farms in China. miRNAs are a kind of ~ 22 nucleotide small non coding RNAs which were encoded by plants, animals and some viruses with functions in RNA silencing or post-transcription regulation. We constructed four sRNA library of P. clarkia from different tissues and treatments by using high-throughput sequencing technology. A total of 101 conserved miRNAs and two novel pre-miRNAs were identified and RT-qPCR were further performed to confirm existence of part of identified miRNAs. A genome wide expression profile of salt-tolerance miRNAs was proved and three miRNAs were further validated by RT-qPCR with dynamic response to different salinity stages. The study of miRNAs in P. clarkia can help us better understanding the role of miRNAs in salt-tolerance in P. clarkia.

Construction and analysis of a library of miRNA in gold-coloured mutant leaves of Ginkgo biloba L.

To gain insights into the regulatory networks of miRNAs related to golden colour formation in Ginkgo biloba leaves, we constructed an sRNA library of golden-green striped mutant leaves. A total of 213 known miRNAs comprising 54 miRNA families were obtained, and 214 novel miRNAs were identified in the mutant leaves. We further constructed a normal green leaf sRNA library as a control and compared the expression of miRNAs between mutant and normal leaves. We found 42 known and 54 novel differential expression candidate miRNAs; 39 were up-regulated and 57 down-regulated in mutants compared to normal leaves. Our transcriptome analysis and annotation of the predicted targets indicated that the potential roles of miRNAs in G. biloba leaves included involvement in the ‘Glutathione metabolism’, ‘Plant circadian rhythm’, and ‘Phenylalanine metabolism’ categories. miRNAs and their targets were further validated by qRT-PCR. The expression of miR159a and miR159c, in particular, was significantly higher in mutant leaves than in normal leaves, while their potential target gene CLT3, which is associated with chloroplast development, displayed the opposite expression pattern. In addition, the expression of miR396g-3p and miR396h was also significantly higher in mutant leaves than in normal leaves, while the target genes ABP1 (auxin-related gene) and PPR32 (chloroplast RNA editing protein), respectively, showed the opposite expression pattern. Combined with the transcriptome analysis, these data suggest that miR159, miR396, and their targets may participate in chloroplast development and hormone metabolism to regulate colour formation in G. biloba leaves.

Broad antifungal resistance mediated by RNAi-dependent epimutation in the basal human fungal pathogen Mucor circinelloides

Mucormycosis - an emergent, deadly fungal infection - is difficult to treat, in part because the causative species demonstrate broad clinical antifungal resistance. However, the mechanisms underlying drug resistance in these infections remain poorly understood. Our previous work demonstrated that one major agent of mucormycosis, Mucor circinelloides, can develop resistance to the antifungal agents FK506 and rapamycin through a novel, transient RNA interference-dependent mechanism known as epimutation. Epimutations silence the drug target gene and are selected by drug exposure; the target gene is re-expressed and sensitivity is restored following passage without drug. This silencing process involves generation of small RNA (sRNA) against the target gene via core RNAi pathway proteins. To further elucidate the role of epimutation in the broad antifungal resistance of Mucor, epimutants were isolated that confer resistance to another antifungal agent, 5-fluoroorotic acid (5-FOA). We identified epimutant strains that exhibit resistance to 5-FOA without mutations in PyrF or PyrG, enzymes which convert 5-FOA into the active toxic form. Using sRNA hybridization as well as sRNA library analysis, we demonstrate that these epimutants harbor sRNA against either pyrF or pyrG, and further show that this sRNA is lost after reversion to drug sensitivity. We conclude that epimutation is a mechanism capable of targeting multiple genes, enabling Mucor to develop resistance to a variety of antifungal agents. Elucidation of the role of RNAi in epimutation affords a fuller understanding of mucormycosis. Furthermore, it improves our understanding of fungal pathogenesis and adaptation to stresses, including the evolution of drug resistance.