scholarly journals Halo Spot Symptom Induced by Oviposition of Frankliniella occidentalis on Grape Fruits: Molecular Diagnosis by a Species-specific DNA Amplification and Microscopic Characterization of the Symptom

2014 ◽  
Vol 53 (3) ◽  
pp. 281-286 ◽  
Author(s):  
Seung-Joon Ahn ◽  
Myoung Rae Cho ◽  
Cheol Hong Park ◽  
Taek Jun Kang ◽  
Hyung Hwan Kim ◽  
...  
Keyword(s):  
Molecular Diagnosis ◽  
Frankliniella Occidentalis ◽  
Dna Amplification ◽  
Species Specific

scholarly journals Characterization of the Major Antigenic Protein 2 of Ehrlichia canis and Ehrlichia chaffeensis and Its Application for Serodiagnosis of Ehrlichiosis

2003 ◽  
Vol 10 (4) ◽  
pp. 520-524 ◽  
Author(s):  
Tamece T. Knowles ◽  
A. Rick Alleman ◽  
Heather L. Sorenson ◽  
David C. Marciano ◽  
Edward B. Breitschwerdt ◽  
...  
Keyword(s):  
Blot Analysis ◽  
Single Copy ◽  
Ehrlichia Canis ◽  
Specific Method ◽  
Ehrlichia Chaffeensis ◽  
Antigenic Protein ◽  
Canine Monocytic Ehrlichiosis ◽  
Copy Gene ◽  
Species Specific

ABSTRACT Canine monocytic ehrlichiosis, caused by Ehrlichia canis or Ehrlichia chaffeensis, can result in clinical disease in naturally infected animals. Coinfections with these agents may be common in certain areas of endemicity. Currently, a species-specific method for serological diagnosis of monocytic ehrlichiosis is not available. Previously, we developed two indirect enzyme-linked immunosorbent assays (ELISAs) using the major antigenic protein 2 (MAP2) of E. chaffeensis and E. canis. In this study, we further characterized the conservation of MAP2 among various geographic isolates of each organism and determined if the recombinant MAP2 (rMAP2) of E. chaffeensis would cross-react with E. canis-infected dog sera. Genomic Southern blot analysis using digoxigenin-labeled species-specific probes suggested that map2 is a single-copy gene in both Ehrlichia species. Sequences of the single map2 genes of seven geographically different isolates of E. chaffeensis and five isolates of E. canis are highly conserved among the various isolates of each respective ehrlichial species. ELISA and Western blot analysis confirmed that the E. chaffeensis rMAP2 failed to serologically differentiate between E. canis and E. chaffeensis infections.

Characterization of trypanosome isolates from cattle in Uganda using species-specific DNA probes reveals predominance of mixed infections

1990 ◽  
Vol 11 (03) ◽  
pp. 271-280
Author(s):  
J. H. P. Nyeko ◽  
O. K. Ole-Moiyoi ◽  
P. A. O. Majiwa ◽  
L. H. Otieno ◽  
P. M. Ociba
Keyword(s):  
Dna Probes ◽  
Mixed Infections ◽  
Species Specific

scholarly journals Development and Validation of a Nested-PCR-Denaturing Gradient Gel Electrophoresis Method for Taxonomic Characterization of Bifidobacterial Communities

2003 ◽  
Vol 69 (11) ◽  
pp. 6380-6385 ◽  
Author(s):  
R. Temmerman ◽  
L. Masco ◽  
T. Vanhoutte ◽  
G. Huys ◽  
J. Swings
Keyword(s):  
Nested Pcr ◽  
Gel Electrophoresis ◽  
Denaturing Gradient Gel Electrophoresis ◽  
Temporal Changes ◽  
Rrna Gene ◽  
Specific Pcr ◽  
Gradient Gel Electrophoresis ◽  
Species Specific ◽  
Taxonomic Characterization

ABSTRACT The taxonomic characterization of a bacterial community is difficult to combine with the monitoring of its temporal changes. None of the currently available identification techniques are able to visualize a “complete” community, whereas techniques designed for analyzing bacterial ecosystems generally display limited or labor-intensive identification potential. This paper describes the optimization and validation of a nested-PCR-denaturing gradient gel electrophoresis (DGGE) approach for the species-specific analysis of bifidobacterial communities from any ecosystem. The method comprises a Bifidobacterium-specific PCR step, followed by purification of the amplicons that serve as template DNA in a second PCR step that amplifies the V3 and V6-V8 regions of the 16S rRNA gene. A mix of both amplicons is analyzed on a DGGE gel, after which the band positions are compared with a previously constructed database of reference strains. The method was validated through the analysis of four artificial mixtures, mimicking the possible bifidobacterial microbiota of the human and chicken intestine, a rumen, and the environment, and of two fecal samples. Except for the species Bifidobacterium coryneforme and B. indicum, all currently known bifidobacteria originating from various ecosystems can be identified in a highly reproducible manner. Because no further cloning and sequencing of the DGGE bands is necessary, this nested-PCR-DGGE technique can be completed within a 24-h span, allowing the species-specific monitoring of temporal changes in the bifidobacterial community.

scholarly journals Characterization of the Bull's Eye Rot of Apple in Chile

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 485-490 ◽  
Author(s):  
Sylvana Soto-Alvear ◽  
Mauricio Lolas ◽  
Inés M. Rosales ◽  
Eduardo R. Chávez ◽  
Bernardo A. Latorre
Keyword(s):  
Morphological Characteristics ◽  
The United States ◽  
Apple Fruit ◽  
Maritime Transportation ◽  
Tubulin Genes ◽  
Internal Transcribed Spacer Sequences ◽  
Apple Production ◽  
Species Specific ◽  
Bull's Eye

Apple fruit in Chile are primarily produced for export to Asia, Europe, and the United States, which typically requires 15 to 40 days of maritime transportation. Therefore, Chilean apple production must fulfill the sanitization requirements imposed by the receiving countries. Under these circumstances, it was important to clarify the etiology of bull's eye rot that can severely affect ‘Cripps Pink’ apple and other late-harvest cultivars in Chile. Based on morphological characteristics and the partial sequence analysis of the internal transcribed spacer sequences and β-tubulin genes, Neofabraea alba was identified as the causal agent of the bull's eye rot of Chilean apple. These results were further corroborated using species-specific primers. The incidence of bull's eye rot varied considerably; for instance, in 2009, 0.0 to 58.7% in 38 Cripps Pink orchards surveyed in the relatively arid and humid apple-growing areas of Chile, respectively. There was no evidence for the presence of N. malicorticis or N. perennans, which are commonly identified as causal agents of bull's eye rot in other apple-producing countries. Altogether, these data suggest that N. alba might represent the predominant and possibly the only cause of bull's-eye rot of Chilean apple.

scholarly journals Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay

2015 ◽  
Vol 9 (1) ◽  
pp. e0003469 ◽  
Author(s):  
Robin H. Miller ◽  
Clifford O. Obuya ◽  
Elizabeth W. Wanja ◽  
Bernhards Ogutu ◽  
John Waitumbi ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Novel Species ◽  
Plasmodium Ovale ◽  
Pcr Assay ◽  
Western Kenya ◽  
Plasmodium Ovale Curtisi ◽  
Species Specific

scholarly journals Bioacoustic characterization of mating calls of a freshwater fish (Prochilodus magdalenae) for passive acoustic monitoring

2021 ◽  
Vol 22 (1) ◽  
Author(s):  
Sebastián Muñoz-Duque ◽  
Silvia López-Casas ◽  
Héctor Rivera-Gutiérrez ◽  
Luz Jiménez-Segura
Keyword(s):  
Pulse Rate ◽  
Peak Frequency ◽  
Acoustic Monitoring ◽  
Passive Acoustic Monitoring ◽  
Natural Habitats ◽  
Train Duration ◽  
Acoustic Characterization ◽  
Species Specific ◽  
Passive Acoustic

Fish produce sounds that are usually species-specific and associated with particular behaviors and contexts. Acoustic characterization enables the use of sounds as natural acoustic labels for species identification. Males of Prochilodus magdalenae produce mating sounds. We characterized  these sounds and tested their use in natural habitats, to use passive acoustic monitoring for spawning ground identification. We identified two types of acoustic signals: simple pulses and pulse trains. Simple pulses were 13.7 ms long, with peak frequency of 365 Hz, whereas pulse train were 2.3 s long, had peak frequency of 399 Hz, 48.6 pulses and its pulses lasted 12.2 ms, with interpulse interval of 49.0 ms long and 22.3 Hz pulse rate. We did not detect spawning in  absence of male calls nor differences in male sounds at different female densities. We found differences in train duration, pulse rate, and pulse duration in trains, according to the fish's source sites, but these sites were not well discriminated based on bioacoustical variables. In rivers, we located two P. magdalenae spawning grounds and recognized calls from another fish species (Megaleporinus muyscorum). We did not find a significant relationship between fish size and call peak frequency for P. magdalenae.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Sign in / Sign up

Export Citation Format

Share Document