scholarly journals Effect of heat-stress predisposition on the development of sooty canker caused by Neoscytalidium dimidiatum (Penz.) Crous and Slippers

2012 ◽  
Vol 64 (4) ◽  
pp. 207-212 ◽  
Author(s):  
Wazeer A. Hassan ◽  
Raed A. Haleem ◽  
Payman H. Hassan
Keyword(s):  
Heat Stress ◽  
Eucalyptus Camaldulensis ◽  
Control Treatment ◽  
Effect Of Temperature ◽  
Post Inoculation ◽  
Susceptible Host ◽  
Neoscytalidium Dimidiatum ◽  
Temperature Regimes ◽  
Before And After ◽  
Canker Development

Sooty canker, caused by <i>Neoscytalidium dimidiatum</i> (Penz.) Crous and Slippers, Synon. = <i>Nattrassia mangiferae</i> (Syd. and P. Syd.) B. Sutton and Dyko, on the inoculated thin bark saplings (12-24 months old) of <i>Eucalyptus camaldulensis</i>, <i>Olea europaea</i>, and <i>Populus nigra</i> was monitored under greenhouse conditions every 2 days until the 8<sup>th</sup> day, and it was repeated 18, 28, 58 days after inoculation. Predisposition to stem cankers depended on the duration of warm temperature and abundance of fungal inoculum. The infected bark was discolored and revealed a black mass of fungal arthroconidia, particularly on the most susceptible plants of eucalyptus and poplar. The cankers extended to 18.53 mm and 16.11 mm on eucalyptus and poplar, respectively, after 58 days compared to 10 mm for non-inoculated saplings (wounding sites) of control treatment. The effect of temperature conditions before and after inoculation with <i>N. dimidiatum</i> on canker development on the same plants was studied in a growth chamber with two temperature regimes, very hot 40<sup>o</sup>C and hot 32<sup>o</sup>C. Among pre-inoculation regimes, very hot and hot temperatures were the most conductive to infection of eucalyptus saplings compared to other hosts, which showed a non-significant dependence between pre- and post-inoculation. Thus, heat stress of 32 and 40<sup>o</sup>C on the most susceptible host, eucalyptus, sustained the progress of cankers to 17.20-17.56 mm after 3 days and 18.08-18.06 mm after 5 days of inoculation.

Physiology of growth and seed production in Lupinus angustifolius L. II. Effect of temperature before and after flowering

1984 ◽  
Vol 35 (4) ◽  
pp. 501 ◽  
Author(s):  
RW Downes ◽  
JS Gladstones
Keyword(s):  
Plant Growth ◽  
Seed Development ◽  
Vegetative Growth ◽  
Seed Weight ◽  
Lupinus Angustifolius ◽  
The Other ◽  
Effect Of Temperature ◽  
Temperature Regimes ◽  
Seed Growth ◽  
Before And After

Plants of Lupinus angustifolius cv. Unicrop, with branches excised to eliminate competition between branches and the primary inflorescence, were raised at 21/16�C and transferred as flowering began to eight temperature regimes from 36/31 to 15/10�C for seed development. Vegetative growth rather than seed growth was stimulated by coolest conditions, although ultimate individual seed weight was greatest at the lowest temperatures. Plant growth was poor at temperatures above 27/22�C. Temperatures about 21/16�C were most suitable for seed development. In another experiment, plants with branches excised were grown at 27/22 or 18/13�C until flowering, when they were either retained in the same conditions or moved to the other. Conditions before flowering determined growth of the inflorescence for the first 24 days after flowering began, but conditions after flowering affected ultimate yield. Plants raised to flowering at 27/22�C were able to recover if exposed to 18/13�C after flowering. This suggested a possible role for lupins as an autumn crop where water is available.

scholarly journals Effects of cooled floor pads combined with chilled drinking water on behavior and performance of lactating sows under heat stress

2021 ◽  
Vol 99 (3) ◽  
Author(s):  
Y Zhu ◽  
L J Johnston ◽  
M H Reese ◽  
E S Buchanan ◽  
J E Tallaksen ◽  
...  
Keyword(s):  
Drinking Water ◽  
Heat Stress ◽  
Respiration Rate ◽  
Rectal Temperature ◽  
Time Budget ◽  
Video Recording ◽  
Lactating Sows ◽  
Before And After ◽  
And Performance ◽  
Drinking Frequency

Abstract This study was conducted to evaluate whether cooled floor pads combined with chilled drinking water could alleviate negative impacts of heat stress on lactating sows. Thirty sows (Landrace × Yorkshire, Parity = 1 to 6) were housed in individual farrowing stalls in two rooms with temperatures being controlled at 29.4°C (0700–1900 hours) and 23.9°C (1900–0700 hours). Sows in one room (Cool), but not in the other room (Control) were provided cooled floor pads (21–22°C) and chilled drinking water (13–15°C). Behavior of sows (15 sows/treatment) was video recorded during farrowing, and days 1, 3, 7, 14, and 21 after farrowing. Videos were viewed continuously to register the birth time of each piglet, from which total farrowing duration and birth intervals were calculated. The number of drinking bouts and the duration of each drinking bout were registered for each sow through viewing videos continuously for 2 h (1530–1730 hours) each video-recording day. Postures (lying laterally, lying ventrally, sitting, and standing) were recorded by scanning video recordings at 5-min intervals for 24 h each video-recording day, and time budget for each posture was calculated. Rectal temperature and respiration rate were measured for all sows the day before and after farrowing, and then once weekly. Sow and litter performance was recorded. Data were analyzed using the Glimmix procedure of SAS. The cooling treatment did not affect sow behavior or litter performance. Sows in the Cool room had lower rectal temperature (P = 0.03) and lower respiration rate (P &lt; 0.001), consumed more feed (P = 0.03), tended to have reduced weight loss (P = 0.07), and backfat loss (P = 0.07) during lactation than sows in the Control room. As lactation progressed, sows increased drinking frequency (P &lt; 0.001) and time spent lying ventrally (P &lt; 0.0001), standing (P &lt; 0.001), and sitting (P &lt; 0.0001), and decreased time spent lying laterally (P &lt; 0.0001) in both Cool and Control rooms. While cooled floor pads combined with chilled drinking water did not affect sow behavior, they did alleviate heat stress partially, as indicated by decreased rectal temperature, respiration rate, weight, and backfat loss, and increased feed intake in lactating sows.

The response of pygmy bluetongue lizards to simulated grazing in the field during three drought years

2012 ◽  
Vol 39 (6) ◽  
pp. 540 ◽  
Author(s):  
Melissa Pettigrew ◽  
C. Michael Bull
Keyword(s):  
Prey Availability ◽  
Careful Consideration ◽  
Grazing Management ◽  
Control Treatment ◽  
Ground Vegetation ◽  
Control Group ◽  
Drought Period ◽  
Before And After ◽  
Simulated Grazing ◽  
Complex Relationships

Context Grazing by domestic stock can directly influence and shape the functions of an ecosystem. Most remaining remnant native grasslands in Australia are under some form of grazing management, with some possible adverse impacts for endemic grassland biota. For the endangered pygmy bluetongue lizard (Tiliqua adelaidensis), grazing of its remnant native grassland habitat has been seen as a potential conservation threat. Aim We aimed to investigate whether lizards altered their basking and foraging behaviour as a response to simulated grazing of the grassland habitat surrounding their burrows. Methods We used field manipulations over 3 years event by manually removing above-ground vegetation in 1 m2 around occupied lizard burrows, to simulate intense grazing events. We video-recorded lizard responses to these manipulations. We filmed lizards before and after the simulated grazing event and monitored basking and foraging response. We also simultaneously filmed a control group of lizards that were not exposed to a simulated grazing event. Key results Although overall time spent basking did not differ between treatment and control groups, the lizards spent more of their basking time completely emerged (bold basking) in the grazing treatment, suggesting they changed behaviour after simulated grazing. Perhaps they were more confident of evading predators that they could more clearly see approaching. In one season lizards made more attempts to catch prey in the grazed treatment than in a control treatment following the treatment, suggesting that grazing might enhance visibility for the ambush predation method that these lizards use. Conclusions The results suggest that grazing may produce some benefits for lizards already established in burrows. This contrasts with some previous results and suggests that management of grazing regimes requires careful consideration of the conditions currently prevalent. In this case, the study was conducted during a drought period, and different results might have emerged in higher rainfall years. Implications Grazing management for lizard conservation requires detailed understanding of the complex relationships among lizard behaviour, vegetation cover and invertebrate prey availability.

Application of Benzotriazole Corrosion Inhibitor in Synthetic-Based Drilling Fluid and its Overall Impact in Improving Drilling Fluid Functionality

2021 ◽  
Author(s):  
Zhao Xionghu ◽  
Saviour Bassey Egwu ◽  
Deng Jingen ◽  
Miao Liujie
Keyword(s):  
Corrosion Rate ◽  
Corrosion Inhibitor ◽  
Coefficient Of Friction ◽  
Hot Rolling ◽  
Drilling Fluid ◽  
Effect Of Temperature ◽  
Fluid Loss ◽  
Fluid Composition ◽  
Fluid System ◽  
Before And After

Abstract The effect of corrosion inhibitor Benzotriazole on synthetic-based mud system was studied. Rheological performance of the benzotriazole enhanced synthetic-based fluid system was studied and compared against the base mud. To study its effect on dynamic wellbore conditions, different drilling fluid compositions were placed in a hot rolling oven for 16 hours at temperatures 150 °C and 170°C and the effect of temperature on mud properties were studied. Tests carried out include rheological test (before and after hot rolling), filtrate pH, lubricity test, and fluid loss test. The corrosion penetration rate was studied using the weight loss method. Based on experiment results, the synthetic-based mud system which comprised of benzotriazole displayed a reduction in coefficient of friction up to 95.93%. At ambient condition, optimal ratio of mineral oil:benzotriazole (M:B) which gives best lubricity performance on synthetic-based mud system is 80:20. This leads to improved corrosion inhibition and lubricity of the synthetic-based fluid by reducing the coefficient of friction up to 90.13%. Increased temperature led to further decrease in coefficient of friction with a % torque reduction of 95.93 displayed by the 80:20 ratio M:B mud composition at 170 °C. Significant alterations of the mud composition rheological and fluid loss parameters before and after exposure to high temperature in hot rolling oven were not observed. pH values were maintained ≥7 at the dynamic conditions highlighting solubility of the formulated fluid composition and absence of contaminants which can pose significant threats to the rates of corrosion in drill pipes. Increasing the concentration of Benzotriazole led to a reduction in corrosion rate. However, as the temperature effect increased, the corrosion rate elevated. Based on results from this investigation, it was concluded that Benzotriazole can be applied as a corrosion inhibitor in a synthetic-based drilling fluid system as an alternative corrosion inhibitor without significant alteration of the base mud properties. Benefits of this will be the optimization of extended reach well drilling operations due to excellent lubricity performance, corrosion rate reduction, compatibility with HPHT wellbore condition and fluid loss control.

scholarly journals Effect of Temperature on Yield and Some Agronomic Characters of Spring Wheat (Triticum aestivum L.) Genotypes

2013 ◽  
Vol 1 (1-2) ◽  
pp. 44-54 ◽  
Author(s):  
Akbar Hossain ◽  
MAZ Sarker ◽  
MA Hakim ◽  
MV Lozovskaya ◽  
VP Zvolinsky
Keyword(s):  
Heat Stress ◽  
Triticum Aestivum L ◽  
Effect Of Temperature ◽  
Yield Reduction ◽  
Agronomic Characters ◽  
Sowing Time ◽  
Wheat Varieties ◽  
Modern Wheat ◽  
Heat Tolerant ◽  
Sensitive Genotype

Eight modern wheat varieties (viz., Sourav, Gourab, Shatabdi, Sufi, Bijoy, Prodip, BARI Gom-25 and BARI Gom-26) were evaluated to find out the suitable variety for optimum and late sown condition, to find out heat tolerant and heat sensitive variety and to find out the optimum sowing time for a specific variety. The experiment was conducted in the research farm of Wheat Research Center (25°38´ N, 88°41´ E and 38.20 m above sea level.), Bangladesh, under eight sowing times (viz., 8 Nov., 15 Nov., 22 Nov., 29 Nov., 6 Dec., 13 Dec., 20 Dec. and 27 Dec.). Results showed that wheat sown in November 22 to December 20 was significantly better compared to November 08, 15 and December 27, from the studied aspects of yield and yield components. Considering overall sowing performance of all genotypes Shatabdi is the best, followed by BARI Gom-26 (2nd), Sourav (3rd), Prodip (4th), Bijoy (5th), Gourab (6th), Sufi (7th) and BARI Gom-25 (least). In extremely heat stress (November 08 and December 27) condition Prodip was found to be heat sensitive genotype (yield reduction 41.18 and 28.92%), followed by BARI Gom-26 (yield reduction 41.15 and 22.73%). Both in too early and very late heat stress conditions, genotypes Sourav and BARI Gom-25 were found to be heat tolerant. In very early (November 08), variety Sourav (yield reduction 20.47%) is recommended, followed by BARI Gom-25 (yield reduction 27.91%) and in very late (December 27), Sufi is the best (yield reduction 8.60%), followed by Bijoy (yield reduction 11.05%). DOI: http://dx.doi.org/10.3329/ijarit.v1i1-2.13932 Int. J. Agril. Res. Innov. & Tech. 1 (1&2): 44-54, December, 2011

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals Dietary Grape (Vitis vinifera) Seed Powder and Zn–Gly Chelate Complex for Mitigating Heat Stress in Broiler Chickens: Growth Parameters, Malondialdehyde, Paraoxonase-1, and Antibody Titer

Agriculture ◽  
2021 ◽  
Vol 11 (11) ◽  
pp. 1087
Author(s):  
Muhammad Israr ◽  
Naila Chand ◽  
Rifat Ullah Khan ◽  
Ibrahim A. Alhidary ◽  
Mutassim M. Abdelrahman ◽  
...  
Keyword(s):  
Heat Stress ◽  
Antibody Titer ◽  
Broiler Chickens ◽  
Growth Traits ◽  
Growth Parameters ◽  
Control Diet ◽  
Paraoxonase 1 ◽  
Control Treatment ◽  
Broiler Chicks ◽  
Feed Conversion

A total of 300 day old broiler chicks (Hubbard) were assigned to 30 floor pens (10 birds per pen) under cyclic heat stress. Three diets including a control, as well as two levels of grape seed powder (GSP) and zinc (OZ) at the rates of 2.5 g/kg GSP + 50 mg/kg OZ and 5 g/kg GSP + 50 mg/kg OZ, were supplied to the broilers for 35 days. According to the results, broiler feed intake improved (p < 0.05) in GSP + OZ groups from 3–5 weeks and on an overall basis compared to the control diet. Body weight increased (p < 0.05) in GSP-5 + OZ-50 during weeks 2–5 and on an overall basis. The findings indicated that feed conversion ratio (FCR) decreased (p < 0.05) during week 5 in broilers supplemented with GSP-5 + OZ-50. The antibody titer (HI) against Newcastle disease (ND) was higher (p < 0.05) in GSP + OZ groups compared to control treatment. The value of malondialdehyde (MDA) decreased (p < 0.05) under GSP + OZ diets compared to control. Moreover, paraoxonase (PON1) was higher (p < 0.05) in GSP + OZ groups compared to untreated broilers. In conclusion, GSP + OZ positively supported growth traits, reduced MDA, and augmented PON1 and HI titer against ND in broilers exposed to heat stress.

scholarly journals Effect of Temperature on the Tribological Properties of Selected Thermoplastic Materials Cooperating with Aluminium Alloy

Materials ◽  
2021 ◽  
Vol 14 (23) ◽  
pp. 7318
Author(s):  
Anita Ptak ◽  
Paula Taciak ◽  
Wojciech Wieleba
Keyword(s):  
Aluminium Alloy ◽  
Contact Pressure ◽  
Tribological Properties ◽  
Polymer Materials ◽  
Effect Of Temperature ◽  
Test Results ◽  
Friction Process ◽  
Before And After ◽  
Pin On Disc ◽  
Two Parameters

This article concerns the tribological properties of three selected polymer materials: polyamide PA6, polyethylene PE-HD and polyetheretherketone composite PEEK/BG during sliding against aluminium alloy EN AW-2017A in the presence of hydraulic oil HLP 68. The tests were carried out under contact pressure p of 3.5–11 MPa at ambient temperature T ranging from −20 °C to +20 °C. The dependence of kinetic friction coefficient μk on the two parameters was determined through tribological tests carried out using a pin-on-disc tribometer. A five-level central composite rotatable design (CCRD) was adopted for the experiment. All the test results were statistically analysed. The microhardness of the surface of the polymeric material was measured before and after the friction process. The surface was also examined under SEM. Temperature and contact pressure have been found to have a significant effect on the tribological properties of the tested sliding pairs. Relative to the applied friction conditions, the surfaces after friction showed rather heavy signs of wear.

scholarly journals MECHANICAL CHARACTERIZATION OF PA 12 AND HDPE PIPES BEFORE AND AFTER AGING IN WATER AT TWO DIFFERENT TEMPERATURES

2021 ◽  
Vol 9 (1) ◽  
pp. 248-256
Author(s):  
J.A. dos Santos ◽  
R.C. Tucunduva ◽  
J.R.M. D’Almeida
Keyword(s):  
High Density Polyethylene ◽  
Mechanical Performance ◽  
High Density ◽  
Effect Of Temperature ◽  
Polyamide 12 ◽  
Polyethylene Pipes ◽  
Before And After ◽  
Different Temperatures ◽  
Deterioration Process ◽  
Combined Action

Polymer pipes are being widely used by many industrial segments. Although not affected by corrosion, the mechanical performance of these pipes can be reduced due to exposure to temperature, UV radiation and by contact with various fluids. Depending on the deterioration process, embrittlement or plasticization may occur, and the service life of the pipe can be severely reduced. In this work, the combined action of temperature and water upon the mechanical performance of polyamide 12 and high-density polyethylene pipes is evaluated. Destructive and non-destructive techniques were used and the performance of both materials was compared. Both polymers were platicized by the effect of water. However, for high density polyethylene the effect of temperature was more relevant than for polyamide. This behavior was attributed to the dependence of the free volume with the markedly different glass transition temperature of the polymers and the temperatures of testing.

scholarly journals Foliar silicate application improves the tolerance of celery grown under heat stress conditions

2021 ◽  
Vol 117 (3) ◽  
pp. 1
Author(s):  
Fadl Abdelhamid HASHEM ◽  
Rasha M. EL-MORSHEDY ◽  
Tarek M. YOUNIS ◽  
Mohamed A. A. ABDRABBO
Keyword(s):  
Heat Stress ◽  
Vegetative Growth ◽  
Foliar Application ◽  
Climate Change Impacts ◽  
Potassium Silicate ◽  
Growth And Yield ◽  
Apium Graveolens ◽  
Control Treatment ◽  
F1 Hybrid ◽  
And Control

<p>Temperature rise is one of the most challenging climate change impacts that increase the intensity of heat stress. In this investigated the production of celery (<em>Apium graveolens</em> var. <em>rapaceum </em>F1 hybrid)) was tested during the late season. The experiment was carried out during the two successive summer seasons of 2019 and 2020 in Giza Governorate, Egypt. The experimental design is a split-plot, the main plots consist of three low tunnel cover treatments, and three spray treatments with three replicates in sub-main plots. Results showed that the use of white net cover gave the highest vegetative growth and yield followed by the black net. Values of plant yield were 951, 765, and 660 g/plant for white, black and without cover, respectively, in the first season. The foliar application of 3 mM of potassium silicate produced the highest vegetative growth and yield compared to the control treatment. Referring to the effect of spray foliar application of potassium silicate on yield 1.5 mM (S1), 3 mM (S2), and control were 892, 795, and 689 g/plant in the first season, respectively. The best combination that delivered the highest vegetative growth and yield was a cover low tunnel with a white net combined with S2 foliar application.</p>

Sign in / Sign up

Export Citation Format

Share Document