scholarly journals Chemo-enzymatic modification of poly-N-acetyllactosamine (LacNAc) oligomers and N,N-diacetyllactosamine (LacDiNAc) based on galactose oxidase treatment

2012 ◽  
Vol 8 ◽  
pp. 712-725 ◽  
Author(s):  
Christiane E Kupper ◽  
Ruben R Rosencrantz ◽  
Birgit Henßen ◽  
Helena Pelantová ◽  
Stephan Thönes ◽  
...  
Keyword(s):  
Reductive Amination ◽  
Chemical Conversion ◽  
Product Formation ◽  
Galactose Oxidase ◽  
Binding Motif ◽  
Enzymatic Modification ◽  
Specific Interest ◽  
Subsequent Reduction ◽  
Binding Studies ◽  
Terminal Galactose

The importance of glycans in biological systems is highlighted by their various functions in physiological and pathological processes. Many glycan epitopes on glycoproteins and glycolipids are based on N-acetyllactosamine units (LacNAc; Galβ1,4GlcNAc) and often present on extended poly-LacNAc glycans ([Galβ1,4GlcNAc] n ). Poly-LacNAc itself has been identified as a binding motif of galectins, an important class of lectins with functions in immune response and tumorigenesis. Therefore, the synthesis of natural and modified poly-LacNAc glycans is of specific interest for binding studies with galectins as well as for studies of their possible therapeutic applications. We present the oxidation by galactose oxidase and subsequent chemical or enzymatic modification of terminal galactose and N-acetylgalactosamine residues of poly-N-acetyllactosamine (poly-LacNAc) oligomers and N,N-diacetyllactosamine (LacDiNAc) by galactose oxidase. Product formation starting from different poly-LacNAc oligomers was characterised and optimised regarding formation of the C6-aldo product. Further modification of the aldehyde containing glycans, either by chemical conversion or enzymatic elongation, was established. Base-catalysed β-elimination, coupling of biotin–hydrazide with subsequent reduction to the corresponding hydrazine linkage, and coupling by reductive amination to an amino-functionalised poly-LacNAc oligomer were performed and the products characterised by LC–MS and NMR analysis. Remarkably, elongation of terminally oxidised poly-LacNAc glycans by β3GlcNAc- and β4Gal-transferase was also successful. In this way, a set of novel, modified poly-LacNAc oligomers containing terminally and/or internally modified galactose residues were obtained, which can be used for binding studies and various other applications.

scholarly journals Mutational Analysis of the Cy Motif from p21 Reveals Sequence Degeneracy and Specificity for Different Cyclin-Dependent Kinases

2001 ◽  
Vol 21 (15) ◽  
pp. 4868-4874 ◽  
Author(s):  
James A. Wohlschlegel ◽  
Brian T. Dwyer ◽  
David Y. Takeda ◽  
Anindya Dutta
Keyword(s):  
Inhibitory Activity ◽  
Mammalian Cells ◽  
Mutational Analysis ◽  
Cyclin E ◽  
Cyclin A ◽  
Binding Motif ◽  
Binding Studies ◽  
Alanine Scanning Mutagenesis ◽  
Cyclin Dependent Kinases

ABSTRACT Inhibitors, activators, and substrates of cyclin-dependent kinases (cdks) utilize a cyclin-binding sequence, known as a Cy or RXL motif, to bind directly to the cyclin subunit. Alanine scanning mutagenesis of the Cy motif of the cdk inhibitor p21 revealed that the conserved arginine or leucine (constituting the conserved RXL sequence) was important for p21's ability to inhibit cyclin E-cdk2 activity. Further analysis of mutant Cy motifs showed, however, that RXL was neither necessary nor sufficient for a functional cyclin-binding motif. Replacement of either of these two residues with small hydrophobic residues such as valine preserved p21's inhibitory activity on cyclin E-cdk2, while mutations in either polar or charged residues dramatically impaired p21's inhibitory activity. Expressing p21N with non-RXL Cy sequences inhibited growth of mammalian cells, providing in vivo confirmation that RXL was not necessary for a functional Cy motif. We also show that the variant Cy motifs identified in this study can effectively target substrates to cyclin-cdk complexes for phosphorylation, providing additional evidence that these non-RXL motifs are functional. Finally, binding studies using p21 Cy mutants demonstrated that the Cy motif was essential for the association of p21 with cyclin E-cdk2 but not with cyclin A-cdk2. Taking advantage of this differential specificity toward cyclin E versus cyclin A, we demonstrate that cell growth inhibition was absolutely dependent on the ability of a p21 derivative to inhibit cyclin E-cdk2.

DNA-binding protein activated by gamma radiation in human cells

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals Calmodulin-dependent activation and inactivation of anoctamin calcium-gated chloride channels

2013 ◽  
Vol 142 (4) ◽  
pp. 381-404 ◽  
Author(s):  
Kerstin Vocke ◽  
Kristin Dauner ◽  
Anne Hahn ◽  
Anne Ulbrich ◽  
Jana Broecker ◽  
...  
Keyword(s):  
Splice Variant ◽  
Chloride Channels ◽  
Cell Types ◽  
Binding Motif ◽  
Binding Studies ◽  
Channel Activation ◽  
Calcium Dependent ◽  
Calmodulin Binding ◽  
Dependent Inactivation ◽  
Cl Channels

Calcium-dependent chloride channels serve critical functions in diverse biological systems. Driven by cellular calcium signals, the channels codetermine excitatory processes and promote solute transport. The anoctamin (ANO) family of membrane proteins encodes three calcium-activated chloride channels, named ANO 1 (also TMEM16A), ANO 2 (also TMEM16B), and ANO 6 (also TMEM16F). Here we examined how ANO 1 and ANO 2 interact with Ca2+/calmodulin using nonstationary current analysis during channel activation. We identified a putative calmodulin-binding domain in the N-terminal region of the channel proteins that is involved in channel activation. Binding studies with peptides indicated that this domain, a regulatory calmodulin-binding motif (RCBM), provides two distinct modes of interaction with Ca2+/calmodulin, one at submicromolar Ca2+ concentrations and one in the micromolar Ca2+ range. Functional, structural, and pharmacological data support the concept that calmodulin serves as a calcium sensor that is stably associated with the RCBM domain and regulates the activation of ANO 1 and ANO 2 channels. Moreover, the predominant splice variant of ANO 2 in the brain exhibits Ca2+/calmodulin-dependent inactivation, a loss of channel activity within 30 s. This property may curtail ANO 2 activity during persistent Ca2+ signals in neurons. Mutagenesis data indicated that the RCBM domain is also involved in ANO 2 inactivation, and that inactivation is suppressed in the retinal ANO 2 splice variant. These results advance the understanding of Ca2+ regulation in anoctamin Cl− channels and its significance for the physiological function that anoctamin channels subserve in neurons and other cell types.

scholarly journals DNA-binding protein activated by gamma radiation in human cells.

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285 ◽  
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals A missense variant in specificity protein 6 (SP6) is associated with amelogenesis imperfecta

2020 ◽  
Vol 29 (9) ◽  
pp. 1417-1425 ◽  
Author(s):  
Claire E L Smith ◽  
Laura L E Whitehouse ◽  
James A Poulter ◽  
Laura Wilkinson Hewitt ◽  
Fatima Nadat ◽  
...  
Keyword(s):  
Dna Binding ◽  
Tooth Enamel ◽  
Missense Variant ◽  
Promoter Sequence ◽  
Amelogenesis Imperfecta ◽  
Proximal Promoter ◽  
Binding Motif ◽  
Binding Studies ◽  
Gene Encoding ◽  
Binding Residue

Abstract Amelogenesis is the process of enamel formation. For amelogenesis to proceed, the cells of the inner enamel epithelium (IEE) must first proliferate and then differentiate into the enamel-producing ameloblasts. Amelogenesis imperfecta (AI) is a heterogeneous group of genetic conditions that result in defective or absent tooth enamel. We identified a 2 bp variant c.817_818GC>AA in SP6, the gene encoding the SP6 transcription factor, in a Caucasian family with autosomal dominant hypoplastic AI. The resulting missense protein change, p.(Ala273Lys), is predicted to alter a DNA-binding residue in the first of three zinc fingers. SP6 has been shown to be crucial to both proliferation of the IEE and to its differentiation into ameloblasts. SP6 has also been implicated as an AI candidate gene through its study in rodent models. We investigated the effect of the missense variant in SP6 (p.(Ala273Lys)) using surface plasmon resonance protein-DNA binding studies. We identified a potential SP6 binding motif in the AMBN proximal promoter sequence and showed that wild-type (WT) SP6 binds more strongly to it than the mutant protein. We hypothesize that SP6 variants may be a very rare cause of AI due to the critical roles of SP6 in development and that the relatively mild effect of the missense variant identified in this study is sufficient to affect amelogenesis causing AI, but not so severe as to be incompatible with life. We suggest that current AI cohorts, both with autosomal recessive and dominant disease, be screened for SP6 variants.

scholarly journals Structural determinants within Pbx1 that mediate cooperative DNA binding with pentapeptide-containing Hox proteins: proposal for a model of a Pbx1-Hox-DNA complex.

1996 ◽  
Vol 16 (4) ◽  
pp. 1632-1640 ◽  
Author(s):  
Q Lu ◽  
M P Kamps
Keyword(s):  
Dna Binding ◽  
Protein A ◽  
Alpha Helix ◽  
Binding Motif ◽  
Binding Studies ◽  
Structural Determinants ◽  
Hox Proteins ◽  
Core Motif ◽  
C Proteins ◽  
Hox Protein

Genetic studies have identified a family of divergent homeodomain proteins, including the human protooncoprotein Pbx1 and its drosophila homolog extradenticle (Exd), which function as cofactors with a subset of Hox and HOM-C proteins, and are essential for specific target gene expression. Pbx1/Exd binds DNA elements cooperatively with a large subset of Hox/HOM-C proteins containing a conserved pentapeptide motif, usually YPWMR, located just N terminally to their homeodomains. The pentapeptide is essential for cooperative DNA binding with Pbx1. In this study, we identify structural determinants of Pbx1 that are required for cooperative DNA binding with the pentapeptide-containing Hox protein HoxA5. We demonstrate that the homeodomain of Pbx1 contains a surface that binds the pentapeptide motif and that the Pbx1 homeodomain is sufficient for cooperative DNA binding with a Hox protein. A sequence immediately C terminal to the Pbx1 homeodomain, which is highly conserved in Pbx2 and Pbx3 and predicted to form an alpha-helix, enhances monomeric DNA binding by Pbx1 and also contributes to maximal cooperativity with Hox proteins. Binding studies with chimeric HoxA5-Pbx1 fusion proteins suggest that the homeodomains of Pbx1 and HoxA5 are docked on the representative element, TTGATTGAT, in tandem, with Pbx1 recognizing the 5' TTGAT core motif and the Hox protein recognizing the 3' TGAT core. The proposed binding orientation permits Hox proteins to exhibit further binding specificity on the basis of the identity of the four residues 3' to their core binding motif.

scholarly journals Kinetic studies of dogfish liver glutamate dehydrogenase

1979 ◽  
Vol 177 (2) ◽  
pp. 449-459 ◽  
Author(s):  
A H Electricwala ◽  
F M Dickinson
Keyword(s):  
Glutamate Dehydrogenase ◽  
Kinetic Data ◽  
Reductive Amination ◽  
Initial Rate ◽  
Kinetic Studies ◽  
Bovine Liver ◽  
Binding Studies ◽  
Degree Of Protection ◽  
Binding Sequence ◽  
Kinetic Features

Initial-rate studies were made of the oxidation of L-glutamate by NAD+ and NADP+ catalysed by highly purified preparations of dogfish liver glutamate dehydrogenase. With NAD+ as coenzyme the kinetics show the same features of coenzyme activation as seen with the bovine liver enzyme [Engel & Dalziel (1969) Biochem. J. 115, 621–631]. With NADP+ as coenzyme, initial rates are much slower than with NAD+, and Lineweaver–Burk plots are linear over extended ranges of substrate and coenzyme concentration. Stopped-flow studies with NADP+ as coenzyme give no evidence for the accumulation of significant concentrations of NADPH-containing complexes with the enzyme in the steady state. Protection studies against inactivation by pyridoxal 5′-phosphate indicate that NAD+ and NADP+ give the same degree of protection in the presence of sodium glutarate. The results are used to deduce information about the mechanism of glutamate oxidation by the enzyme. Initial-rate studies of the reductive amination of 2-oxoglutarate by NADH and NADPH catalysed by dogfish liver glutamate dehydrogenase showed that the kinetic features of the reaction are very similar with both coenzymes, but reactions with NADH are much faster. The data show that a number of possible mechanisms for the reaction may be discarded, including the compulsory mechanism (previously proposed for the enzyme) in which the sequence of binding is NAD(P)H, NH4+ and 2-oxoglutarate. The kinetic data suggest either a rapid-equilibrium random mechanism or the compulsory mechanism with the binding sequence NH4+, NAD(P)H, 2-oxoglutarate. However, binding studies and protection studies indicate that coenzyme and 2-oxoglutarate do bind to the free enzyme.

Smooth muscle membrane vesicle orientation: a study on intactness and sidedness of rat myometrium plasma membrane vesicles

1980 ◽  
Vol 58 (10) ◽  
pp. 1202-1211 ◽  
Author(s):  
A. K. Grover ◽  
J. Crankshaw ◽  
R. E. Garfield ◽  
E. E. Daniel
Keyword(s):  
Plasma Membrane ◽  
G Protein ◽  
Membrane Vesicle ◽  
Membrane Vesicles ◽  
Shock Treatment ◽  
Galactose Oxidase ◽  
Muscle Membrane ◽  
Plasma Membrane Vesicles ◽  
Binding Studies ◽  
Hypotonic Shock

Plasma membrane vesicles of rat myometrium were prepared in media containing 240 mM sucrose. The vesicles were exposed to isotonic, hypertonic, and hypotonic sucrose concentrations, fixed, sectioned, and studied using the electron microscope. The vesicles fixed in isotonic media were circular in appearance. Vesicles fixed in hypertonic media were distorted and showed a reduced volume to surface ratio consistent with the hypothesis that >80% of the vesicles were osmotically active to sucrose. Cationized ferritin binding studies and Ca binding and release studies were also consistent with this finding. Exposure to hypotonic media also yielded membranes with distorted profiles indicating that they had been ruptured. [3H]Sucrose trapping experiments revealed that the vesicles had an internal volume of 1.20–1.44 mL/g protein. Hypotonic shock treatment reduced this intravesicular volume to 0.20–0.28 mL/g protein. The hypotonic shock treatment also led to enhanced galactose oxidase catalyzed Na3B3H4 labelling of the membranes and to increased K+-activated ouabain-sensitive p-nitrophenyl phosphatase activity. The enhancement was the same (55 ± 10%) in the various membrane preparations for both the parameters. The data are interpreted to conclude that the rat myometrium plasma membrane vesicles consisted of 20% broken vesicles and equal proportions of intact vesicles of inside-out and rightside-out orientations.

scholarly journals Characterization of the cholera toxin receptor on Balb/c 3T3 cells as a ganglioside similar to, or identical with, ganglioside GM1. No evidence for galactoproteins with receptor activity

1982 ◽  
Vol 204 (1) ◽  
pp. 209-219 ◽  
Author(s):  
D R Critchley ◽  
C H Streuli ◽  
S Kellie ◽  
S Ansell ◽  
B Patel
Keyword(s):  
Cholera Toxin ◽  
Polyacrylamide Gel Electrophoresis ◽  
Sodium Dodecyl ◽  
Receptor Activity ◽  
Galactose Oxidase ◽  
3T3 Cells ◽  
Ganglioside Gm1 ◽  
Intact Cells ◽  
Terminal Galactose ◽  
Toxin Receptor

Balb/c 3T3 cells contain a large number [(0.8-1.6) x 10(6)] of high-affinity (half-maximal binding at 0.2 nM) binding sites for cholera toxin that are resistant to proteolysis, but are quantitatively extracted with chloroform/methanol. The following evidence rigorously establishes that the receptor is a ganglioside similar to, or identical with, ganglioside GM1 by the galactose oxidase/NaB3H4 technique on intact cells was inhibited by cholera toxin. (2) Ganglioside GM1 was specifically adsorbed from Nonidet P40 extracts of both surface- (galactose oxidase/NaB3H4 technique) and metabolically ([1-14C]palmitate) labelled cells in the presence of cholera toxin, anti-toxin and Staphylococcus aureus. (3) Ganglioside GM1 was the only ganglioside labelled when total cellular gangliosides separated on silica-gel sheets were overlayed with 125I-labelled cholera toxin, although GM3 and GD1a were the major gangliosides present. In contrast no evidence for a galactoprotein with receptor activity was obtained. Cholera toxin did not protect the terminal galactose residues of cell-surface glycoproteins from labelling by the galactose oxidase/NaB3H4 technique. No toxin-binding proteins could be identified in Nonidet P40 extracts of [35S]-methionine-labelled cells by immunochemical means. After sodium dodecyl sulphate/polyacrylamide-gel electrophoresis none of the major cellular galactoproteins identified by overlaying gels with 125I-labelled ricin were able to bind 125I-labelled cholera toxin. It is concluded that the cholera toxin receptor on Balb/c 3T3 cells is exclusively ganglioside GM1 (or a related species), and that cholera toxin can therefore be used to probe the function and organisation of gangliosides in these cells as previously outlined [Critchley, Ansell, Perkins, Dilks & Ingram (1979) J. Supramol. Struct. 12, 273-291].

Sign in / Sign up

Export Citation Format

Share Document