scholarly journals A missense variant in specificity protein 6 (SP6) is associated with amelogenesis imperfecta

2020 ◽  
Vol 29 (9) ◽  
pp. 1417-1425 ◽  
Author(s):  
Claire E L Smith ◽  
Laura L E Whitehouse ◽  
James A Poulter ◽  
Laura Wilkinson Hewitt ◽  
Fatima Nadat ◽  
...  
Keyword(s):  
Dna Binding ◽  
Tooth Enamel ◽  
Missense Variant ◽  
Promoter Sequence ◽  
Amelogenesis Imperfecta ◽  
Proximal Promoter ◽  
Binding Motif ◽  
Binding Studies ◽  
Gene Encoding ◽  
Binding Residue

Abstract Amelogenesis is the process of enamel formation. For amelogenesis to proceed, the cells of the inner enamel epithelium (IEE) must first proliferate and then differentiate into the enamel-producing ameloblasts. Amelogenesis imperfecta (AI) is a heterogeneous group of genetic conditions that result in defective or absent tooth enamel. We identified a 2 bp variant c.817_818GC>AA in SP6, the gene encoding the SP6 transcription factor, in a Caucasian family with autosomal dominant hypoplastic AI. The resulting missense protein change, p.(Ala273Lys), is predicted to alter a DNA-binding residue in the first of three zinc fingers. SP6 has been shown to be crucial to both proliferation of the IEE and to its differentiation into ameloblasts. SP6 has also been implicated as an AI candidate gene through its study in rodent models. We investigated the effect of the missense variant in SP6 (p.(Ala273Lys)) using surface plasmon resonance protein-DNA binding studies. We identified a potential SP6 binding motif in the AMBN proximal promoter sequence and showed that wild-type (WT) SP6 binds more strongly to it than the mutant protein. We hypothesize that SP6 variants may be a very rare cause of AI due to the critical roles of SP6 in development and that the relatively mild effect of the missense variant identified in this study is sufficient to affect amelogenesis causing AI, but not so severe as to be incompatible with life. We suggest that current AI cohorts, both with autosomal recessive and dominant disease, be screened for SP6 variants.

DNA-binding protein activated by gamma radiation in human cells

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals Crystal Structures of the BlaI Repressor from Staphylococcus aureus and Its Complex with DNA: Insights into Transcriptional Regulation of the bla and mec Operons

2005 ◽  
Vol 187 (5) ◽  
pp. 1833-1844 ◽  
Author(s):  
Martin K. Safo ◽  
Qixun Zhao ◽  
Tzu-Ping Ko ◽  
Faik N. Musayev ◽  
Howard Robinson ◽  
...  
Keyword(s):  
Staphylococcus Aureus ◽  
Dna Binding ◽  
Crystal Structures ◽  
Double Helix ◽  
Free Form ◽  
Binding Motif ◽  
Dimerization Domain ◽  
Gene Encoding ◽  
Dna Binding Sites ◽  
Dna Double Helix

ABSTRACT The 14-kDa BlaI protein represses the transcription of blaZ, the gene encoding β-lactamase. It is homologous to MecI, which regulates the expression of mecA, the gene encoding the penicillin binding protein PBP2a. These genes mediate resistance to β-lactam antibiotics in staphylococci. Both repressors can bind either bla or mec DNA promoter-operator sequences. Regulated resistance genes are activated via receptor-mediated cleavage of the repressors. Cleavage is induced when β-lactam antibiotics bind the extramembrane sensor of the sensor-transducer signaling molecules, BlaR1 or MecR1. The crystal structures of BlaI from Staphylococcus aureus, both in free form and in complex with 32 bp of DNA of the mec operator, have been determined to 2.0- and 2.7-Å resolutions, respectively. The structure of MecI, also in free form and in complex with the bla operator, has been previously reported. Both repressors form homodimers, with each monomer composed of an N-terminal DNA binding domain of winged helix-turn-helix topology and a C-terminal dimerization domain. The structure of BlaI in complex with the mec operator shows a protein-DNA interface that is conserved between both mec and bla targets. The recognition helix α3 interacts specifically with the conserved TACA/TGTA DNA binding motif. BlaI and, probably, MecI dimers bind to opposite faces of the mec DNA double helix in an up-and-down arrangement, whereas MecI and, probably, BlaI dimers bind to the same DNA face of bla promoter-operator DNA. This is due to the different spacing of mec and bla DNA binding sites. Furthermore, the flexibility of the dimeric proteins may make the C-terminal proteolytic cleavage site more accessible when the repressors are bound to DNA than when they are in solution, suggesting that the induction cascade involves bound rather than free repressor.

scholarly journals DNA-binding protein activated by gamma radiation in human cells.

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285 ◽  
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals Structural determinants within Pbx1 that mediate cooperative DNA binding with pentapeptide-containing Hox proteins: proposal for a model of a Pbx1-Hox-DNA complex.

1996 ◽  
Vol 16 (4) ◽  
pp. 1632-1640 ◽  
Author(s):  
Q Lu ◽  
M P Kamps
Keyword(s):  
Dna Binding ◽  
Protein A ◽  
Alpha Helix ◽  
Binding Motif ◽  
Binding Studies ◽  
Structural Determinants ◽  
Hox Proteins ◽  
Core Motif ◽  
C Proteins ◽  
Hox Protein

Genetic studies have identified a family of divergent homeodomain proteins, including the human protooncoprotein Pbx1 and its drosophila homolog extradenticle (Exd), which function as cofactors with a subset of Hox and HOM-C proteins, and are essential for specific target gene expression. Pbx1/Exd binds DNA elements cooperatively with a large subset of Hox/HOM-C proteins containing a conserved pentapeptide motif, usually YPWMR, located just N terminally to their homeodomains. The pentapeptide is essential for cooperative DNA binding with Pbx1. In this study, we identify structural determinants of Pbx1 that are required for cooperative DNA binding with the pentapeptide-containing Hox protein HoxA5. We demonstrate that the homeodomain of Pbx1 contains a surface that binds the pentapeptide motif and that the Pbx1 homeodomain is sufficient for cooperative DNA binding with a Hox protein. A sequence immediately C terminal to the Pbx1 homeodomain, which is highly conserved in Pbx2 and Pbx3 and predicted to form an alpha-helix, enhances monomeric DNA binding by Pbx1 and also contributes to maximal cooperativity with Hox proteins. Binding studies with chimeric HoxA5-Pbx1 fusion proteins suggest that the homeodomains of Pbx1 and HoxA5 are docked on the representative element, TTGATTGAT, in tandem, with Pbx1 recognizing the 5' TTGAT core motif and the Hox protein recognizing the 3' TGAT core. The proposed binding orientation permits Hox proteins to exhibit further binding specificity on the basis of the identity of the four residues 3' to their core binding motif.

scholarly journals Identification of the varR Gene as a Transcriptional Regulator of Virginiamycin S Resistance inStreptomyces virginiae

2001 ◽  
Vol 183 (6) ◽  
pp. 2025-2031 ◽  
Author(s):  
Wises Namwat ◽  
Chang-Kwon Lee ◽  
Hiroshi Kinoshita ◽  
Yasuhiro Yamada ◽  
Takuya Nihira
Keyword(s):  
Dna Binding ◽  
Promoter Region ◽  
Northern Blot Analysis ◽  
Binding Activity ◽  
Binding Motif ◽  
Dependent Manner ◽  
Gene Encoding ◽  
Dna Binding Activity ◽  
Streptomyces Virginiae

ABSTRACT A gene designated varR (for virginiaeantibiotic resistance regulator) was identified in Streptomyces virginiae 89 bp downstream of a varS gene encoding a virginiamycin S (VS)-specific transporter. The deduced varRproduct showed high homology to repressors of the TetR family with a conserved helix-turn-helix DNA binding motif. Purified recombinant VarR protein was present as a dimer in vitro and showed clear DNA binding activity toward the varS promoter region. This binding was abolished by the presence of VS, suggesting that VarR regulates transcription of varS in a VS-dependent manner. Northern blot analysis revealed that varR was cotranscribed with upstream varS as a 2.4-kb transcript and that VS acted as an inducer of bicistronic transcription. Deletion analysis of thevarS promoter region clarified two adjacent VarR binding sites in the varS promoter.

scholarly journals AP2 transcription factor CBX1 with a specific function in symbiotic exchange of nutrients in mycorrhizal Lotus japonicus

2018 ◽  
Vol 115 (39) ◽  
pp. E9239-E9246 ◽  
Author(s):  
Li Xue ◽  
Lompong Klinnawee ◽  
Yue Zhou ◽  
Georgios Saridis ◽  
Vinod Vijayakumar ◽  
...  
Keyword(s):  
Transcription Factor ◽  
Fatty Acid ◽  
Dna Binding ◽  
Molecular Mechanisms ◽  
De Novo ◽  
Phosphate Uptake ◽  
Lotus Japonicus ◽  
Binding Motif ◽  
Binding Studies ◽  
Am Symbiosis

The arbuscular mycorrhizal (AM) symbiosis, a widespread mutualistic association between land plants and fungi, depends on reciprocal exchange of phosphorus driven by proton-coupled phosphate uptake into host plants and carbon supplied to AM fungi by host-dependent sugar and lipid biosynthesis. The molecular mechanisms and cis-regulatory modules underlying the control of phosphate uptake and de novo fatty acid synthesis in AM symbiosis are poorly understood. Here, we show that the AP2 family transcription factor CTTC MOTIF-BINDING TRANSCRIPTION FACTOR1 (CBX1), a WRINKLED1 (WRI1) homolog, directly binds the evolutionary conserved CTTC motif that is enriched in mycorrhiza-regulated genes and activates Lotus japonicus phosphate transporter 4 (LjPT4) in vivo and in vitro. Moreover, the mycorrhiza-inducible gene encoding H+-ATPase (LjHA1), implicated in energizing nutrient uptake at the symbiotic interface across the periarbuscular membrane, is coregulated with LjPT4 by CBX1. Accordingly, CBX1-defective mutants show reduced mycorrhizal colonization. Furthermore, genome-wide–binding profiles, DNA-binding studies, and heterologous expression reveal additional binding of CBX1 to AW box, the consensus DNA-binding motif for WRI1, that is enriched in promoters of glycolysis and fatty acid biosynthesis genes. We show that CBX1 activates expression of lipid metabolic genes including glycerol-3-phosphate acyltransferase RAM2 implicated in acylglycerol biosynthesis. Our finding defines the role of CBX1 as a regulator of host genes involved in phosphate uptake and lipid synthesis through binding to the CTTC/AW molecular module, and supports a model underlying bidirectional exchange of phosphorus and carbon, a fundamental trait in the mutualistic AM symbiosis.

scholarly journals Direct Interaction of SRY-Related Protein SOX9 and Steroidogenic Factor 1 Regulates Transcription of the Human Anti-Müllerian Hormone Gene

1998 ◽  
Vol 18 (11) ◽  
pp. 6653-6665 ◽  
Author(s):  
Pascal De Santa Barbara ◽  
Nathalie Bonneaud ◽  
Brigitte Boizet ◽  
Marion Desclozeaux ◽  
Brigitte Moniot ◽  
...  
Keyword(s):  
Dna Binding ◽  
Sertoli Cell ◽  
Molecular Mechanisms ◽  
Proximal Promoter ◽  
Activation Process ◽  
Orphan Nuclear Receptor ◽  
Binding Studies ◽  
Specific Expression ◽  
Steroidogenic Factor 1

ABSTRACT For proper male sexual differentiation, anti-Müllerian hormone (AMH) must be tightly regulated during embryonic development to promote regression of the Müllerian duct. However, the molecular mechanisms specifying the onset of AMH in male mammals are not yet clearly defined. A DNA-binding element for the steroidogenic factor 1 (SF-1), a member of the orphan nuclear receptor family, located in the AMH proximal promoter has recently been characterized and demonstrated as being essential for AMH gene activation. However, the requirement for a specific promoter environment for SF-1 activation as well as the presence of conserved cis DNA-binding elements in the AMH promoter suggest that SF-1 is a member of a combinatorial protein-protein and protein-DNA complex. In this study, we demonstrate that the canonical SOX-binding site within the human AMH proximal promoter can bind the transcription factor SOX9, a Sertoli cell factor closely associated with Sertoli cell differentiation and AMH expression. Transfection studies with COS-7 cells revealed that SOX9 can cooperate with SF-1 in this activation process. In vitro and in vivo protein-binding studies indicate that SOX9 and SF-1 interact directly via the SOX9 DNA-binding domain and the SF-1 C-terminal region, respectively. We propose that the two transcription factors SOX9 and SF-1 could both be involved in the expression of the AMH gene, in part as a result of their respective binding to the AMH promoter and in part because of their ability to interact with each other. Our work thus identifies SOX9 as an interaction partner of SF-1 that could be involved in the Sertoli cell-specific expression of AMH during embryogenesis.

Towards understanding the mechanism of action of mithramycin and its analogues: dimerization and DNA binding studies

Planta Medica ◽  
2016 ◽  
Vol 81 (S 01) ◽  
pp. S1-S381
Author(s):  
S Weidenbach ◽  
C Hou ◽  
JM Chen ◽  
OV Tsodikov ◽  
J Rohr
Keyword(s):  
Dna Binding ◽  
Mechanism Of Action ◽  
Binding Studies ◽  
Dna Binding Studies

Metal Based Pharmacological Active Agents: Structural, Electrochemical, DNA Binding Studies and Antibacterial Properties

2015 ◽  
Vol 9 (4) ◽  
pp. 210-218 ◽  
Author(s):  
Harun Muslu ◽  
Derya Kılıcaslan ◽  
Mustafa Cesme ◽  
Aysegul Golcu ◽  
Sibel Ozkan
Keyword(s):  
Dna Binding ◽  
Antibacterial Properties ◽  
Binding Studies ◽  
Dna Binding Studies
Sign in / Sign up

Export Citation Format

Share Document