scholarly journals Identification of an Emaravirus in a Common Oak (Quercus robur L.) Conservation Seed Orchard in Germany: Implications for Oak Health

Forests ◽  
2020 ◽  
Vol 11 (11) ◽  
pp. 1174 ◽  
Author(s):  
Martina Bandte ◽  
Marius Rehanek ◽  
Bertram Leder ◽  
Susanne von Bargen ◽  
Carmen Büttner
Keyword(s):  
High Throughput Sequencing ◽  
Leaf Tissue ◽  
Seed Orchard ◽  
Clear Correlation ◽  
The Novel ◽  
Rt Pcr ◽  
Oak Trees ◽  
Symptomatic Leaf ◽  
Novel Virus ◽  
Pcr Targeting

We observed the health status of oak trees in a conservation seed orchard for over twenty years, focusing on characteristic virus-suspected symptoms. The orchard was established in 1992 in Kreuztal, North Rhine-Westphalia (Germany) with 1302 seedlings in 186 clusters. The number of seedlings showing chlorotic ringspots and mottle on leaves has fluctuated annually, but has increased from 3.3% to 12.1% in the last 20 years; the number of affected clusters has risen from 8% to 25.9%. A scientific breakthrough was the identification of a novel virus related to members of the genus Emaravirus in diseased oak by high-throughput sequencing (HTS). Screening of the oak seedlings in three consecutive years, using a newly established virus-specific diagnostic reverse transcription polymerase chain reaction (RT-PCR), confirmed the virus infection and revealed a close to 100% association between the observed leaf symptoms and the novel virus. As no other plant virus could be identified in the HTS-datasets, we assume the novel virus is primarily causing the symptoms. To reliably detect the novel virus in oaks, RT-PCR targeting the viral RNA3 or RNA4 should be applied in routine testing of symptomatic leaf tissue. It was obvious that most groups with virus-infected plants cluster, with only five out of the 42 affected groups being offside, not bordering on other affected groups of plants. There was no clear correlation between the detection of the virus and the overall vitality of the seedlings. There was no relation between seedling performance and presence or absence of viral infection. Forecasts on the future growth behavior of these virus-infected oak trees are therefore not possible.

scholarly journals Characterization of a Novel Emaravirus Affecting Ash Species (Fraxinus spp.) in Europe

Forests ◽  
2021 ◽  
Vol 12 (11) ◽  
pp. 1574
Author(s):  
Thomas R. Gaskin ◽  
Max Tischendorf ◽  
Ines Günther ◽  
Marius Rehanek ◽  
Carmen Büttner ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Phylogenetic Analyses ◽  
Leaf Tissue ◽  
Spherical Particles ◽  
Infected Leaf ◽  
Rt Pcr ◽  
Glycoprotein Precursor ◽  
A Genome ◽  
Leaf Deformation ◽  
Novel Virus

We identified a novel virus in diseased European ash (Fraxinus excelsior) and manna ash (F. ornus) trees exhibiting chlorotic ringspots, mottle and leaf deformation such as curling and shoestring symptoms. High-throughput sequencing (HTS, Illumina RNASeq) of total RNA isolated from diseased leaf material in combination with RT-PCR-based amplification techniques and Sanger sequencing determined five complete genome segments, each encoding a single open reading frame. Sequence analyses of RNA1–RNA5 revealed a genome organization typical for emaraviruses, i.e., (i) conserved and complementary terminal 5′and 3′termini of each genome segment (ii) proteins showing significant homologies to the RNA-dependent RNA polymerase (RdRP) encoded by RNA1, the glycoprotein precursor (GPP) encoded by RNA2, the viral nucleocapsid protein (N, RNA3), the movement protein (MP, RNA4), and a protein of 26 kDA (P26, RNA5) highly similar to proteins of unknown function encoded by other emaraviruses. Furthermore, we identified spherical particles (double-membrane bodies, DMB) of different sizes (70–80 nm in diameter) which are typical for emaraviruses exclusively in virus-infected leaf tissue exhibiting mottle and leaf deformation. Sequence comparison and phylogenetic analyses confirmed the identified novel virus as a new member of the genus Emaravirus. We established a species-specific RT-PCR detection protocol and could associate the observed disease symptoms with the infection of the novel emaravirus in F. excelsior and F. ornus. Therefore, we propose the name ash shoestring-associated emaravirus (ASaV). Investigation of ASaV-infected sample trees originating from different locations in Switzerland, Germany, Italy and Sweden provided a wide geographical distribution of the virus in affected ash species. To our knowledge, this is the first confirmation of an emaravirus affecting ash tree species with shoestring symptoms of leaves in Europe.

scholarly journals Development and Evaluation of A CRISPR-based Diagnostic For 2019-novel Coronavirus

2020 ◽  
Author(s):  
Tieying Hou ◽  
Weiqi Zeng ◽  
Minling Yang ◽  
Wenjing Chen ◽  
Lili Ren ◽  
...  
Keyword(s):  
Single Copy ◽  
Health Concern ◽  
The Novel ◽  
Rt Pcr ◽  
Clinical Sensitivity ◽  
Reverse Transcription Pcr ◽  
Technology Platforms ◽  
Novel Virus ◽  
Novel Coronavirus ◽  
High Degree

BackgroundThe recent outbreak of infections by the 2019 novel coronavirus (2019-nCoV), the third zoonotic CoV has raised great public health concern. The demand for rapid and accurate diagnosis of this novel pathogen brought significant clinical and technological challenges. Currently, metagenomic next-generation sequencing (mNGS) and reverse-transcription PCR (RT-PCR) are the most widely used molecular diagnostics for 2019-nCoV.Methods2019-nCoV infections were confirmed in 52 specimens by mNGS. Genomic information was analyzed and used for the design and development of an isothermal, CRISPR-based diagnostic for the novel virus. The diagnostic performance of CRISPR-nCoV was assessed and also compared across three technology platforms (mNGS, RT-PCR and CRISPR)Results2019-nCoVs sequenced in our study were conserved with the Wuhan strain, and shared certain genetic similarity with SARS-CoV. A high degree of variation in the level of viral RNA was observed in clinical specimens. CRISPR-nCoV demonstrated a near single-copy sensitivity and great clinical sensitivity with a shorter turn-around time than RT-PCR.ConclusionCRISPR-nCoV presents as a promising diagnostic option for the emerging pathogen.

scholarly journals Identification of a Novel Hepacivirus in Domestic Cattle from Germany

2015 ◽  
Vol 89 (14) ◽  
pp. 7007-7015 ◽  
Author(s):  
Christine Baechlein ◽  
Nicole Fischer ◽  
Adam Grundhoff ◽  
Malik Alawi ◽  
Daniela Indenbirken ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
De Novo ◽  
Dairy Herd ◽  
Herd Size ◽  
Rt Pcr ◽  
Emerging Pathogens ◽  
Content Type ◽  
Zoonotic Infections ◽  
Novel Virus ◽  
Cattle Herds

ABSTRACTHepatitis C virus (HCV) continues to represent one of the most significant threats to human health. In recent years, HCV-related sequences have been found in bats, rodents, horses, and dogs, indicating a widespread distribution of hepaciviruses among animals. By applying unbiased high-throughput sequencing, a novel virus of the genusHepaciviruswas discovered in a bovine serum sample.De novoassembly yielded a nearly full-length genome coding for a polyprotein of 2,779 amino acids. Phylogenetic analysis confirmed that the virus represents a novel species within the genusHepacivirus. Viral RNA screening determined that 1.6% (n =5) of 320 individual animals and 3.2% (n =5) of 158 investigated cattle herds in Germany were positive for bovine hepacivirus. Repeated reverse transcription-PCR (RT-PCR) analyses of animals from one dairy herd proved that a substantial percentage of cows were infected, with some of them being viremic for over 6 months. Clinical and postmortem examination revealed no signs of disease, including liver damage. Interestingly, quantitative RT-PCR from different organs and tissues, together with the presence of an miR-122 binding site in the viral genome, strongly suggests a liver tropism for bovine hepacivirus, making this novel virus a promising animal model for HCV infections in humans.IMPORTANCELivestock animals act as important sources for emerging pathogens. In particular, their large herd size and the existence of multiple ways of direct and food-borne infection routes emphasize their role as virus reservoirs. Apart from the search for novel viruses, detailed characterization of these pathogens is indispensable in the context of risk analysis. Here, we describe the identification of a novel HCV-like virus in cattle. In addition, determination of the prevalence and of the course of infection in cattle herds provides valuable insights into the biology of this novel virus. The results presented here form a basis for future studies targeting viral pathogenesis of bovine hepaciviruses and their potential to establish zoonotic infections.

scholarly journals A novel emaravirus comprising five RNA segments is associated with ringspot disease in oak

2021 ◽  
Vol 166 (3) ◽  
pp. 987-990
Author(s):  
Marius Rehanek ◽  
Susanne von Bargen ◽  
Martina Bandte ◽  
David G. Karlin ◽  
Carmen Büttner
Keyword(s):  
High Throughput Sequencing ◽  
Bioinformatic Analysis ◽  
High Plains ◽  
Rt Pcr ◽  
Viral Origin ◽  
Complete Sequences ◽  
Novel Virus ◽  
Rapid Amplification ◽  
Full Length Genome ◽  
Common Oak

AbstractWe report the complete nucleotide sequence of the genome of a novel virus in ringspot-diseased common oak (Quercus robur L.). The newly identified pathogen is associated with leaf symptoms such as mottle, chlorotic spots and ringspots on diseased trees. High-throughput sequencing (HTS, Illumina RNASeq) was used to explore the virome of a ringspot-diseased oak that had chlorotic ringspots of suspected viral origin on leaves for several years. Bioinformatic analysis of the HTS dataset followed by RT-PCR enabled us to determine complete sequences of four RNA genome segments of a novel virus. These sequences showed high similarity to members of the genus Emaravirus, which includes segmented negative-stranded RNA viruses of economic importance. To verify the ends of each RNA, we conducted rapid amplification of cDNA ends (RACE). We identified an additional genome segment (RNA 5) by RT-PCR using a genus-specific primer (PDAP213) to the conserved 3´ and 5´termini in order to amplify full-length genome segments. RNA 5 encodes a 21-kDa protein that is homologous to the silencing suppressor P8 of High Plains wheat mosaic virus. The five viral RNAs were consistently detected by RT-PCR in ringspot-diseased oaks in Germany, Sweden, and Norway. We conclude that the virus represents a new member of the genus Emaravirus affecting oaks in Germany and in Scandinavia, and we propose the name “common oak ringspot-associated emaravirus” (CORaV).

scholarly journals Persistence of SARS-COV-2 in body fluids: a bystander or whistle blower

2020 ◽  
Author(s):  
Ishani Bora ◽  
Sanjib Gogoi ◽  
Vaishnavi Venkatasubramanian ◽  
Roshan Mathew ◽  
Ritin Mohindra
Keyword(s):  
Clinical Improvement ◽  
Body Fluids ◽  
The Novel ◽  
Test Results ◽  
Rt Pcr ◽  
Clinical Recovery ◽  
Novel Virus ◽  
Novel Coronavirus ◽  
Government Authority ◽  
Pcr Test

The novel Coronavirus COVID-19 is wrecking a havoc across the globe and has been declared as a pandemic by WHO. Apart from transmission and shedding of the virus through respiratory secretions in the form of droplets (mainly), several studies have shown the presence of the virus in various samples such as stool, urine and occasionally in blood, semen, tears and breastmilk. Whereas government authority guidelines consider a person as cured from COVID-19 when along with clinical improvement no more virus can be detected primarily on respiratory samples along with clinical improvement; the persistence of the virus in these body fluids even after clinical recovery and negative RT-PCR test results on respiratory samples, has raised many questions about the elusive nature of this novel virus along with the possibility of other routes of transmission of this virus in the community. Although studies performed till now across the globe on persistence of SARSCOV-2 in various body fluids are sparse, in this review we would like to present and analyse the results of those studies performed globally on the aforesaid topic to get a better insight of this side of the COVID-19 story.

scholarly journals First report of black currant-associated rhabdovirus in blackcurrants in Latvia

Plant Disease ◽  
2021 ◽  
Author(s):  
Nikita Zrelovs ◽  
Gunta Resevica ◽  
Ieva Kalnciema ◽  
Helvijs Niedra ◽  
Gunārs Lācis ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Leaf Tissue ◽  
Pairwise Alignment ◽  
Natural Occurrence ◽  
Rt Pcr ◽  
Cdna Synthesis ◽  
Black Currant ◽  
Cycle Sequencing ◽  
N Protein ◽  
The Impact

Blackcurrants (Ribes nigrum) are among the most important commercial berry crops in Latvia and, together with redcurrants and gooseberries, have a long history of local cultivation and breeding (Zuļģe et al. 2018). So far at least 20 viruses were reported to infect Ribes plants (Špak et al. 2021). Blackcurrant-associated rhabdovirus (BCaRV) was previously identified in USA by high throughput sequencing (HTS) of blackcurrant germplasm accession introduced from Russia (isolate Veloy) and now serves as an exemplar isolate for BCaRV (Wu et al. 2018). Presence of BCaRV was also confirmed by RT-PCR in blackcurrant germplasm accession of cv. Burga from France during the same study by Wu et al. (2018). Currently Blackcurrant betanucleorhabdovirus is one of the nine species recognized by ICTV in genus Betanucleorhabdovirus of family Rhabdoviridae, but the impact of BCaRV on the host still remains unknown. Leaf tissue from twelve asymptomatic blackcurrant cv. Mara Eglite plants that negatively tested for blackcurrant reversion virus from Dobele, Latvia (56°36'31.9"N, 23°18'13.6"E) was collected on May 17, 2019 and used for HTS study of local Ribes resistance genes. Total RNA from the leaf tissue of sampled plants was isolated following a method described by Kalinowska et al. (2012) with minor modifications. Briefly, RNeasy Plant Mini Kit (QIAGEN) was used with RLC lysis buffer being supplemented with 2% PVP and 1% β-mercaptoethanol. Plant rRNA was subsequently removed by a RiboMinus Plant Kit for RNA-Seq (Thermo Fisher Scientific (TFS)) prior to cDNA library construction. HTS libraries were prepared using MGIEasy RNA Directional Library Prep Set for 16 reactions (MGI), following a protocol for 150 bp pair-end reads. According to the manufacturers guidelines libraries were pooled, circularized and cleaned before being subjected to sequencing on DNBSEQ-G400 (MGI) using PE150 flow cell (MGI). The sequencing run yielded a total of 393660492 150 bp long read pairs. Reads were assembled into transcripts using rnaSPAdes v 3.13.1 (Bushmanova et al. 2019) and a 14424 base long contig with an average coverage of 684x was found to be 99.5% identical (14358/14432 identities and 8 gaps in the pairwise alignment) to the previously reported first complete genome of BCaRV (MF543022.1) using EMBOSS Needle (Madeira et al., 2019). This contig representing the genome of BCaRV isolate Mara Eglite, onto which 66768 of the raw reads could be mapped, was subsequently deposited at European Nucleotide Archive under accession number OU015520. All of the twelve individual samples were also tested for the presence of BCaRV by RT-PCR, using Verso cDNA Synthesis Kit with random hexamer primers (TFS) for first strand cDNA synthesis followed by PCR with N protein nested primers BCaRV-N-F (5’ AGATGTGCTTCATCGATGGCTAGTTCTGCT 3’) and BCaRV-N-R (5’ TGCATTCCCACGGGTTAGGAATACATTGGTACT 3’) resulting in a 243 bp long fragment for six of the samples. RT-PCR products from six BCaRV positive samples were directly sequenced by Sanger-based method using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with BCaRV-N-F and BCaRV-N-R primers. Acquired RT-PCR product sequences matched the corresponding region of BCaRV isolate Mara Eglite genome assembled from HTS data. In this report, we have documented the natural occurrence of BCaRV in Latvia, which makes it a second evidence on the presence of BCaRV in Europe.

scholarly journals A Description of the Possible Etiology of the Cilantro Yellow Blotch Disease

Plant Disease ◽  
2020 ◽  
Vol 104 (3) ◽  
pp. 630-633
Author(s):  
Olufemi J. Alabi ◽  
Brianna C. Gaytán ◽  
Maher Al Rwahnih ◽  
Cecilia Villegas
Keyword(s):  
High Throughput Sequencing ◽  
Disease Incidence ◽  
Natural Infection ◽  
Alfalfa Mosaic Virus ◽  
Leaf Tissue ◽  
Rt Pcr ◽  
Specific Primers ◽  
Tissue Samples ◽  
Pcr Assays ◽  
Hidalgo County

A virus-like disease characterized by foliar yellow blotch symptoms and resembling those described for cilantro yellow blotch disease in California was observed in a 4.05-ha cilantro (Coriandrum sativum) cv. Santo field in Hidalgo County, Texas during spring 2019. Disease incidence at harvest was estimated at ∼20%, and the affected plants were rendered unmarketable. Foliar systemic chlorosis symptoms were observed on sap-inoculated Nicotiana occidentalis plants (n = 3) using inocula from symptomatic cilantro. Total RNA aliquots from 11 randomly collected leaf tissue samples (symptomatic = 7, asymptomatic = 4) were pooled into a composite cilantro RNA sample which was analyzed by high throughput sequencing (HTS). Analyses of the obtained 15.7 million raw reads (76 nt each) yielded virus-specific contigs that mapped to the genomes of alfalfa mosaic virus (AMV), beet pseudoyellows virus (BPYV), and lettuce chlorosis virus (LCV). Virus-specific primers designed from the HTS-derived sequences were used to screen the samples in two-step RT-PCR assays, resulting in the detection of AMV+BPYV in 3 of 7 symptomatic cilantro samples, AMV+LCV in 4 of 7 symptomatic cilantro samples, and AMV alone in the 4 asymptomatic cilantro and sap-inoculated N. occidentalis samples. The results represent the first reports of the natural infection of cilantro by BPYV and LCV and implicate the mixed infection of a Crinivirus and AMV in cilantro yellow blotch disease.

scholarly journals A Member of a New Picornaviridae Genus Is Shed in Pig Feces

2012 ◽  
Vol 86 (18) ◽  
pp. 10036-10046 ◽  
Author(s):  
Virginie Sauvage ◽  
Meriadeg Ar Gouilh ◽  
Justine Cheval ◽  
Erika Muth ◽  
Kevin Pariente ◽  
...  
Keyword(s):  
Viral Genome ◽  
High Throughput Sequencing ◽  
Enteric Infection ◽  
Nonstructural Proteins ◽  
Rt Pcr ◽  
Fecal Samples ◽  
Content Type ◽  
Reading Frame ◽  
One Step ◽  
Pcr Targeting

During a study of the fecal microbiomes from two healthy piglets using high-throughput sequencing (HTS), we identified a viral genome containing an open reading frame encoding a predicted polyprotein of 2,133 amino acids. This novel viral genome displayed the typical organization of picornaviruses, containing three structural proteins (VP0, VP3, and VP1), followed by seven nonstructural proteins (2A, 2B, 2C, 3A, 3B, 3Cpro, and 3Dpol). Given its particular relationship withParechovirus, we propose to name it “Pasivirus” forParechosister clade virus, with “Swine pasivirus 1” (SPaV1) as the type species. Fecal samples collected at an industrial farm from healthy sows and piglets from the same herd (25 and 75, respectively) with ages ranging from 4 to 28 weeks were analyzed for the presence of SPaV1 by one-step reverse transcription (RT)-PCR targeting a 3D region of 151 bp. SPaV1 was detected in fecal samples from 51/75 healthy piglets (68% of the animals) and in none of the 25 fecal samples from healthy sows, indicating that SPaV1 circulates through enteric infection of healthy piglets. We propose that SPaV1 represents the first member of a novelPicornaviridaegenus related to parechoviruses.

scholarly journals Reassortment of Genome Segments Creates Stable Lineages Among Strains of Orchid Fleck Virus Infecting Citrus in Mexico

2020 ◽  
Vol 110 (1) ◽  
pp. 106-120 ◽  
Author(s):  
Avijit Roy ◽  
Andrew L. Stone ◽  
Gabriel Otero-Colina ◽  
Gang Wei ◽  
Ronald H. Brlansky ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Sensu Stricto ◽  
Genome Segment ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
Orchid Fleck Virus ◽  
Reverse Transcription Pcr ◽  
Sequencing Technologies ◽  
Negative Sense

The genus Dichorhavirus contains viruses with bipartite, negative-sense, single-stranded RNA genomes that are transmitted by flat mites to hosts that include orchids, coffee, the genus Clerodendrum, and citrus. A dichorhavirus infecting citrus in Mexico is classified as a citrus strain of orchid fleck virus (OFV-Cit). We previously used RNA sequencing technologies on OFV-Cit samples from Mexico to develop an OFV-Cit–specific reverse transcription PCR (RT-PCR) assay. During assay validation, OFV-Cit–specific RT-PCR failed to produce an amplicon from some samples with clear symptoms of OFV-Cit. Characterization of this virus revealed that dichorhavirus-like particles were found in the nucleus. High-throughput sequencing of small RNAs from these citrus plants revealed a novel citrus strain of OFV, OFV-Cit2. Sequence comparisons with known orchid and citrus strains of OFV showed variation in the protein products encoded by genome segment 1 (RNA1). Strains of OFV clustered together based on host of origin, whether orchid or citrus, and were clearly separated from other dichorhaviruses described from infected citrus in Brazil. The variation in RNA1 between the original (now OFV-Cit1) and the new (OFV-Cit2) strain was not observed with genome segment 2 (RNA2), but instead, a common RNA2 molecule was shared among strains of OFV-Cit1 and -Cit2, a situation strikingly similar to OFV infecting orchids. We also collected mites at the affected groves, identified them as Brevipalpus californicus sensu stricto, and confirmed that they were infected by OFV-Cit1 or with both OFV-Cit1 and -Cit2. OFV-Cit1 and -Cit2 have coexisted at the same site in Toliman, Queretaro, Mexico since 2012. OFV strain-specific diagnostic tests were developed.

scholarly journals Evaluation of an Automated High-Throughput Liquid-Based RNA Extraction Platform on Pooled Nasopharyngeal or Saliva Specimens for SARS-CoV-2 RT-PCR

Viruses ◽  
2021 ◽  
Vol 13 (4) ◽  
pp. 615
Author(s):  
Allen Wing-Ho Chu ◽  
Cyril Chik-Yan Yip ◽  
Wan-Mui Chan ◽  
Anthony Chin-Ki Ng ◽  
Dream Lok-Sze Chan ◽  
...  
Keyword(s):  
Nucleic Acid ◽  
High Throughput ◽  
Rna Extraction ◽  
Nasopharyngeal Swab ◽  
Acid Extraction ◽  
Rt Pcr ◽  
Nucleic Acid Extraction ◽  
Suitable Alternative ◽  
Pcr Inhibitors ◽  
Pcr Targeting

SARS-CoV-2 RT-PCR with pooled specimens has been implemented during the COVID-19 pandemic as a cost- and manpower-saving strategy for large-scale testing. However, there is a paucity of data on the efficiency of different nucleic acid extraction platforms on pooled specimens. This study compared a novel automated high-throughput liquid-based RNA extraction (LRE) platform (PHASIFYTM) with a widely used magnetic bead-based total nucleic acid extraction (MBTE) platform (NucliSENS® easyMAG®). A total of 60 pools of nasopharyngeal swab and 60 pools of posterior oropharyngeal saliva specimens, each consisting of 1 SARS-CoV-2 positive and 9 SARS-CoV-2 negative specimens, were included for the comparison. Real-time RT-PCR targeting the SARS-CoV-2 RdRp/Hel gene was performed, and GAPDH RT-PCR was used to detect RT-PCR inhibitors. No significant differences were observed in the Ct values and overall RT-PCR positive rates between LRE and MBTE platforms (92.5% (111/120] vs 90% (108/120]), but there was a slightly higher positive rate for LRE (88.3% (53/60]) than MBTE (81.7% (49/60]) among pooled saliva. The automated LRE method is comparable to a standard MBTE method for the detection of SAR-CoV-2 in pooled specimens, providing a suitable alternative automated extraction platform. Furthermore, LRE may be better suited for pooled saliva specimens due to more efficient removal of RT-PCR inhibitors.

Sign in / Sign up

Export Citation Format

Share Document