Updating Zika Diagnostic Methods: The Point-of-Care Approach

2020 ◽  
Author(s):  
Mirna Burciaga-Flores ◽  
Marissa Reyes-Galeana ◽  
Tanya A. Camacho-Villegas ◽  
Abel Gutiérrez-Ortega ◽  
Darwin E. Elizondo-Quiroga
Keyword(s):  
Point Of Care ◽  
Diagnostic Methods ◽  
Care Approach

Trends in Diagnosis for Active Tuberculosis Using Nanomaterials

2019 ◽  
Vol 26 (11) ◽  
pp. 1946-1959 ◽  
Author(s):  
Le Minh Tu Phan ◽  
Lemma Teshome Tufa ◽  
Hwa-Jung Kim ◽  
Jaebeom Lee ◽  
Tae Jung Park
Keyword(s):  
Sensitivity And Specificity ◽  
High Efficiency ◽  
Point Of Care ◽  
High Sensitivity ◽  
Signs And Symptoms ◽  
Diagnostic Methods ◽  
Advantages And Disadvantages ◽  
Treatment And Prevention ◽  
Clinical Tools ◽  
Diagnostic Applications

Background:Tuberculosis (TB), one of the leading causes of death worldwide, is difficult to diagnose based only on signs and symptoms. Methods for TB detection are continuously being researched to design novel effective clinical tools for the diagnosis of TB.Objective:This article reviews the methods to diagnose TB at the latent and active stages and to recognize prospective TB diagnostic methods based on nanomaterials.Methods:The current methods for TB diagnosis were reviewed by evaluating their advantages and disadvantages. Furthermore, the trends in TB detection using nanomaterials were discussed regarding their performance capacity for clinical diagnostic applications.Results:Current methods such as microscopy, culture, and tuberculin skin test are still being employed to diagnose TB, however, a highly sensitive point of care tool without false results is still needed. The utilization of nanomaterials to detect the specific TB biomarkers with high sensitivity and specificity can provide a possible strategy to rapidly diagnose TB. Although it is challenging for nanodiagnostic platforms to be assessed in clinical trials, active TB diagnosis using nanomaterials is highly expected to achieve clinical significance for regular application. In addition, aspects and future directions in developing the high-efficiency tools to diagnose active TB using advanced nanomaterials are expounded.Conclusion:This review suggests that nanomaterials have high potential as rapid, costeffective tools to enhance the diagnostic sensitivity and specificity for the accurate diagnosis, treatment, and prevention of TB. Hence, portable nanobiosensors can be alternative effective tests to be exploited globally after clinical trial execution.

scholarly journals Point of Care Diagnostics in the Age of COVID-19

Diagnostics ◽  
2020 ◽  
Vol 11 (1) ◽  
pp. 9
Author(s):  
Meysam Rezaei ◽  
Sajad Razavi Bazaz ◽  
Sareh Zhand ◽  
Nima Sayyadi ◽  
Dayong Jin ◽  
...  
Keyword(s):  
Point Of Care ◽  
Diagnostic Methods ◽  
Global Public Health ◽  
Current Standard ◽  
Healthcare Facilities ◽  
Major Threat ◽  
Point Of Care Diagnostics ◽  
Recent Outbreak ◽  
Control Virus ◽  
Biosafety Level

The recent outbreak of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and its associated serious respiratory disease, coronavirus disease 2019 (COVID-19), poses a major threat to global public health. Owing to the lack of vaccine and effective treatments, many countries have been overwhelmed with an exponential spread of the virus and surge in the number of confirmed COVID-19 cases. Current standard diagnostic methods are inadequate for widespread testing as they suffer from prolonged turn-around times (>12 h) and mostly rely on high-biosafety-level laboratories and well-trained technicians. Point-of-care (POC) tests have the potential to vastly improve healthcare in several ways, ranging from enabling earlier detection and easier monitoring of disease to reaching remote populations. In recent years, the field of POC diagnostics has improved markedly with the advent of micro- and nanotechnologies. Due to the COVID-19 pandemic, POC technologies have been rapidly innovated to address key limitations faced in existing standard diagnostic methods. This review summarizes and compares the latest available POC immunoassay, nucleic acid-based and clustered regularly interspaced short palindromic repeats- (CRISPR)-mediated tests for SARS-CoV-2 detection that we anticipate aiding healthcare facilities to control virus infection and prevent subsequent spread.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

A point-of-care diagnostic for differentiating Ebola from endemic febrile diseases

2018 ◽  
Vol 10 (471) ◽  
pp. eaat0944 ◽  
Author(s):  
David Sebba ◽  
Alexander G. Lastovich ◽  
Melody Kuroda ◽  
Eric Fallows ◽  
Joshua Johnson ◽  
...  
Keyword(s):  
Ebola Virus ◽  
Clinical Symptoms ◽  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Outbreak Detection ◽  
Molecular Diagnostic ◽  
Clinical Samples ◽  
Live Virus ◽  
And Control

Hemorrhagic fever outbreaks such as Ebola are difficult to detect and control because of the lack of low-cost, easily deployable diagnostics and because initial clinical symptoms mimic other endemic diseases such as malaria. Current molecular diagnostic methods such as polymerase chain reaction require trained personnel and laboratory infrastructure, hindering diagnostics at the point of need. Although rapid tests such as lateral flow can be broadly deployed, they are typically not well-suited for differentiating among multiple diseases presenting with similar symptoms. Early detection and control of Ebola outbreaks require simple, easy-to-use assays that can detect and differentiate infection with Ebola virus from other more common febrile diseases. Here, we developed and tested an immunoassay technology that uses surface-enhanced Raman scattering (SERS) tags to simultaneously detect antigens from Ebola, Lassa, and malaria within a single blood sample. Results are provided in <30 min for individual or batched samples. Using 190 clinical samples collected from the 2014 West African Ebola outbreak, along with 163 malaria positives and 233 negative controls, we demonstrated Ebola detection with 90.0% sensitivity and 97.9% specificity and malaria detection with 100.0% sensitivity and 99.6% specificity. These results, along with corresponding live virus and nonhuman primate testing of an Ebola, Lassa, and malaria 3-plex assay, indicate the potential of the SERS technology as an important tool for outbreak detection and clinical triage in low-resource settings.

Intestinal ultrasonography: a useful skill for efficient, non-invasive monitoring of patients with IBD using a clinic-based point-of-care approach

2021 ◽  
pp. flgastro-2021-101852
Author(s):  
Uday N Shivaji ◽  
Jonathan P Segal ◽  
Andrew A Plumb ◽  
Mohammad Nabil Quraishi ◽  
Subrata Ghosh ◽  
...  
Keyword(s):  
Point Of Care ◽  
Invasive Monitoring ◽  
Non Invasive ◽  
Care Approach

scholarly journals The Use of Motion Analysis as Particle Biomarkers in Lensless Optofluidic Projection Imaging for Point of Care Urine Analysis

2019 ◽  
Vol 9 (1) ◽  
Author(s):  
Jessica Kun ◽  
Marek Smieja ◽  
Bo Xiong ◽  
Leyla Soleymani ◽  
Qiyin Fang
Keyword(s):  
Trichomonas Vaginalis ◽  
Moving Objects ◽  
Urine Analysis ◽  
Point Of Care ◽  
White Blood Cells ◽  
Diagnostic Methods ◽  
Particle Analysis ◽  
Term Care ◽  
Wide Range ◽  
Urine Testing

AbstractUrine testing is an essential clinical diagnostic tool. The presence of urine sediments, typically analyzed through microscopic urinalysis or cell culture, can be indicative of many diseases, including bacterial, parasitic, and yeast infections, as well as more serious conditions like bladder cancer. Current urine analysis diagnostic methods are usually centralized and limited by high cost, inconvenience, and poor sensitivity. Here, we developed a lensless projection imaging optofluidic platform with motion-based particle analysis to rapidly detect urinary constituents without the need for concentration or amplification through culture. A removable microfluidics channel ensures that urine samples do not cross contaminate and the lens-free projection video is captured and processed by a low-cost integrated microcomputer. A motion tracking and analysis algorithm is developed to identify and track moving objects in the flow. Their motion characteristics are used as biomarkers to detect different urine species in near real-time. The results show that this technology is capable of detection of red and white blood cells, Trichomonas vaginalis, crystals, casts, yeast and bacteria. This cost-effective device has the potential to be implemented for timely, point-of-care detection of a wide range of disorders in hospitals, clinics, long-term care homes, and in resource-limited regions.

scholarly journals Bovine Babesiosis in Turkey: Impact, Current Gaps, and Opportunities for Intervention

Pathogens ◽  
2020 ◽  
Vol 9 (12) ◽  
pp. 1041
Author(s):  
Sezayi Ozubek ◽  
Reginaldo G. Bastos ◽  
Heba F. Alzan ◽  
Abdullah Inci ◽  
Munir Aktas ◽  
...  
Keyword(s):  
Vaccine Development ◽  
Point Of Care ◽  
Animal Health ◽  
Current Control ◽  
Diagnostic Methods ◽  
Control Measures ◽  
Bovine Babesiosis ◽  
Research Programs ◽  
The Impact

Bovine babesiosis is a global tick-borne disease that causes important cattle losses and has potential zoonotic implications. The impact of bovine babesiosis in Turkey remains poorly characterized, but several Babesia spp., including B. bovis, B. bigemina, and B. divergens, among others and competent tick vectors, except Rhipicephalus microplus, have been recently identified in the country. Bovine babesiosis has been reported in all provinces but is more prevalent in central and highly humid areas in low and medium altitude regions of the country housing approximately 70% of the cattle population. Current control measures include acaricides and babesicidal drugs, but not live vaccines. Despite the perceived relevant impact of bovine babesiosis in Turkey, basic research programs focused on developing in vitro cultures of parasites, point-of-care diagnostic methods, vaccine development, “omics” analysis, and gene manipulation techniques of local Babesia strains are scarce. Additionally, no effective and coordinated control efforts managed by a central animal health authority have been established to date. Development of state-of-the-art research programs in bovine babesiosis to address current gaps in knowledge and implementation of long-term plans to control the disease will surely result in important economic, nutritional, and public health benefits for the country and the region.

Anticoagulation services in Malta - an economic study comparing a central laboratory model vs. a point-of-care approach

2010 ◽  
Vol 33 (3) ◽  
pp. e7-e8
Author(s):  
Gordon Zammit ◽  
Ryan Farrugia ◽  
Chris Barbara ◽  
Lilian Azzopardi ◽  
Anthony Serracino Inglott ◽  
...  
Keyword(s):  
Point Of Care ◽  
Laboratory Model ◽  
Central Laboratory ◽  
Economic Study ◽  
Care Approach

scholarly journals Rapid and sensitive RPA-Cas12a-fluorescence assay for point-of-care detection of African swine fever virus

PLoS ONE ◽  
2021 ◽  
Vol 16 (7) ◽  
pp. e0254815
Author(s):  
Jinyu Fu ◽  
Yueping Zhang ◽  
Guang Cai ◽  
Geng Meng ◽  
Shuobo Shi
Keyword(s):  
African Swine Fever Virus ◽  
Point Of Care ◽  
African Swine Fever ◽  
High Sensitivity ◽  
Fluorescence Assay ◽  
Fever Virus ◽  
Diagnostic Methods ◽  
High Morbidity ◽  
Swine Industry ◽  
Control And Prevention

African swine fever (ASF) is a serious contagious disease that causes fatal haemorrhagic fever in domestic and wild pigs, with high morbidity. It has caused devastating damage to the swine industry worldwide, necessitating the focus of attention on detection of the ASF pathogen, the African swine fever virus (ASFV). In order to overcome the disadvantages of conventional diagnostic methods (e.g. time-consuming, demanding and unintuitive), quick detection tools with higher sensitivity need to be explored. In this study, based on the conserved p72 gene sequence of ASFV, we combined the Cas12a-based assay with recombinase polymerase amplification (RPA) and a fluorophore-quencher (FQ)-labeled reporter assay for rapid and visible detection. Five crRNAs designed for Cas12a-based assay showed specificity with remarkable fluorescence intensity under visual inspection. Within 20 minutes, with an initial concentration of two copies of DNA, the assay can produce significant differences between experimental and negative groups, indicating the high sensitivity and rapidity of the method. Overall, the developed RPA-Cas12a-fluorescence assay provides a fast and visible tool for point-of-care ASFV detection with high sensitivity and specificity, which can be rapidly performed on-site under isothermal conditions, promising better control and prevention of ASF.

scholarly journals Diagnostic optical sequencing

2019 ◽  
Author(s):  
Lee E. Korshoj ◽  
Prashant Nagpal
Keyword(s):  
Single Molecule ◽  
Point Of Care ◽  
Cost Effective ◽  
Diagnostic Methods ◽  
Sequencing Platform ◽  
Molecular Variants ◽  
Cost Effective Method ◽  
Wide Range ◽  
Lactamase Gene ◽  
Modified Nucleobases

AbstractAdvances in precision medicine require high-throughput, inexpensive, point-of-care diagnostic methods with multi-omics capability for detecting a wide range of biomolecules and their molecular variants. Optical techniques have offered many promising advances towards such diagnostics. However, the inability to squeeze light with several hundred-nanometer wavelengths into angstrom-scale volume for single nucleotide measurements has hindered further progress. Recently, a block optical sequencing (BOS) method has been shown for determining relative nucleobase content in DNA k-mer blocks with Raman spectroscopy, and a block optical content scoring (BOCS) algorithm was developed for robust content-based genetic biomarker database searching. Here, we performed BOS measurements on positively-charged silver nanoparticles to achieve 93.3% accuracy for predicting nucleobase content in DNA k-mer blocks (where k=10), as well as measurements on RNA and chemically-modified nucleobases for extensions to transcriptomic and epigenetic studies. Our high-accuracy BOS measurements were then used with BOCS to correctly identify a β-lactamase gene from the MEGARes antibiotic resistance database and confirm the Pseudomonas aeruginosa pathogen of origin from <12 content measurements (<15% coverage) of the gene. These results prove the integration of BOS/BOCS as a diagnostic optical sequencing platform. With the versatile range of available plasmonic substrates offering simple data acquisition, varying resolution (single-molecule to ensemble), and multiplexing, this optical sequencing platform has potential as the rapid, cost-effective method needed for broad-spectrum biomarker detection.

Sign in / Sign up

Export Citation Format

Share Document