The Use of Real-Time Polymerase Chain Reaction Combined with Specific-Species Primer for Analysis of Dog Meat DNA in Meatball

2020 ◽  
Vol 21 (1) ◽  
pp. 225
Author(s):  
Abdul Rohman ◽  
Wiranti Sri Rahayu ◽  
Sudjadi Sudjadi ◽  
Sudibyo Martono
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Dna Analysis ◽  
Limit Of Detection ◽  
Specific Primer ◽  
Chain Reaction ◽  
Relative Standard ◽  
Polymerase Chain ◽  
Species Specific

The presence of dog meat is a crucial issue because dog meat is non-halal meat for Muslims. The objective of this study was to design and validate species-specific primer for the identification of dog meat DNA in meatball using real-time polymerase chain reaction (real-time PCR). The specific primer targeting mitochondrial cytochrome c oxidase subunit 1 (CO1) was validated. The specific primers used were designed using Integrated DNA Technologies (IDT) software and subjected to NCBI BLAST procedure. The candidate primers were tested for specificity study using several DNAs from fresh meat of pork, chicken, beef, lamb, and rat. The method was also validated by determining several parameters of linearity, sensitivity, precision, and efficiency. The results showed that primer could amplify specifically DNA target at an optimized annealing temperature of 56.6 °C. The limit of detection (LoD) obtained was 5 ng DNA, corresponding to 2.5% of dog meat in a meatball. The repeatability evaluation, expressed with relative standard deviation (RSD), and efficiency value was in the acceptable range (RSD < 25% and efficiency (90–105%). This method was successfully used for the analysis of marketed samples. Real-time PCR can be used as a standard method in halal authentication analysis through DNA analysis.

scholarly journals Evaluation method for asymmetric uncertainty of quantitative polymerase chain reaction measurements of deoxyribonucleic acids with low copy number

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Unoh Ki ◽  
Takeru Suzuki ◽  
Satoshi Nakazawa ◽  
Yuuki Yonekawa ◽  
Kazuki Watanabe ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Confidence Interval ◽  
Real Time ◽  
Real Time Pcr ◽  
Copy Number ◽  
Limit Of Detection ◽  
Quantitative Polymerase Chain Reaction ◽  
Chain Reaction ◽  
Low Copy Number ◽  
Polymerase Chain

AbstractRecently, in food safety and various other fields, qualitative and quantitative gene analysis using real-time polymerase chain reaction (PCR) method has become increasingly popular. The limit of detection (LOD) and quantifiable range for these measurements depends on the range and precision of DNA calibrators’ concentrations. Low-copy-number nucleic acid reference materials with low uncertainty produced by an inkjet system have been developed to allow for precise measurements in a low-copy-number region. However, when using a calibrator with a low copy number near one, the copy number distribution is asymmetric. Consequently, the confidence intervals of estimated copy numbers can include negative values when conventional methods of uncertainty estimation are used. A negative confidence interval is irrelevant in the context of copy number, which is always positive value or zero. Here, we propose a method to evaluate the uncertainty of real-time PCR measurements with representative values and an asymmetric 95% confidence interval. Moreover, we use the proposed method for the actual calculation of uncertainty of real-time PCR measurement results for low-copy-number DNA samples and demonstrate that the proposed method can evaluate the precision of real-time PCR measurements more appropriately in a low-copy-number region.

scholarly journals Validation of a Real-Time Polymerase Chain Reaction Assay for the Identification of Meloidogyne arenaria

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 835-838 ◽  
Author(s):  
Paula Agudelo ◽  
Stephen A. Lewis ◽  
Bruce A. Fortnum
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Soil Samples ◽  
Meloidogyne Arenaria ◽  
Chain Reaction ◽  
Pcr Assay ◽  
The Real ◽  
Polymerase Chain ◽  
Species Specific

Meloidogyne arenaria is an economically important parasite of many crops worldwide. Identification and detection of this species in soil samples is necessary for the design of crop rotation systems, selection of resistant cultivars, and potential use of biological control options. The objective of this study was to develop and validate a real-time polymerase chain reaction (PCR) assay, using species-specific primers and SYBR Green I Dye, for identification of M. arenaria. The specificity of the assay was confirmed by testing for amplification of DNA from other Meloidogyne spp. and from M. arenaria populations of different geographic origins. Field soil samples containing a mixture of M. arenaria and M. incognita were used to compare identification by the real-time PCR assay with identification by esterase phenotype analysis of mature females and by morphometrics of juveniles. The real-time PCR assay provided an accurate and sensitive means for the identification of single juveniles from soil samples.

Immunomagnetic Purging of Ewing’s Sarcoma From Blood and Bone Marrow: Quantitation by Real-Time Polymerase Chain Reaction

2001 ◽  
Vol 19 (16) ◽  
pp. 3649-3659 ◽  
Author(s):  
Margret E. Merino ◽  
Fariba Navid ◽  
Barbara L. Christensen ◽  
Jeffrey A. Toretsky ◽  
Lee J. Helman ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Ewing’S Sarcoma ◽  
Ewing's Sarcoma ◽  
Limit Of Detection ◽  
Clinical Samples ◽  
Chain Reaction ◽  
New Approach ◽  
Polymerase Chain

PURPOSE: A propensity for hematogenous spread with resulting contamination of autologous cell products complicates cellular therapies for Ewing’s sarcoma. We used a new approach to purge artificially contaminated cellular specimens of Ewing’s sarcoma and show the capacity for real-time polymerase chain reaction (PCR) to quantify the contamination level of Ewing’s sarcoma in such specimens. PATIENTS AND METHODS: Binding of monoclonal antibody (MoAb) 8H9 to Ewing’s sarcoma cell lines and normal hematopoietic cells was studied using flow cytometry. Using real-time PCR–based amplification of t(11;22), levels of Ewing’s contamination of experimental and clinical cellular products were monitored. Purging was accomplished using immunomagnetic-based depletion. Monitoring of the function of residual hematopoietic progenitors and T cells was performed using functional assays. RESULTS: MoAb 8H9 shows binding to Ewing’s sarcoma but spares normal hematopoietic tissues. Nested real-time PCR is capable of detecting contaminating Ewing’s sarcoma cells with a sensitivity of one cell in 106 normal cells. After 8H9-based purging, a 2- to 3-log reduction in contaminating Ewing’s sarcoma was shown by real-time PCR, with purging to PCR negativity at levels of contamination of 1:106. Levels of contamination in clinical samples ranged from 1:105 to 106. Therefore, 8H9-based purging of clinical samples is predicted to reduce tumor cell contamination to a level below the limit of detection of PCR. CONCLUSION: These results demonstrate a new approach for purging contaminated cellular products of Ewing’s sarcoma and demonstrate the capacity of real-time PCR to provide accurate quantitative estimates of circulating tumor burden in this disease.

scholarly journals Development of Quantitative Real-Time Polymerase Chain Reaction for Detection of and Discrimination between Erysipelothrix Rhusiopathiae and Other Erysipelothrix Species

2009 ◽  
Vol 21 (5) ◽  
pp. 701-706 ◽  
Author(s):  
Ho To ◽  
Tomohiro Koyama ◽  
Shinya Nagai ◽  
Kotaro Tuchiya ◽  
Tetsuo Nunoya
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Limit Of Detection ◽  
Enrichment Culture ◽  
Bacterial Species ◽  
Erysipelothrix Rhusiopathiae ◽  
Chain Reaction ◽  
Tissue Samples ◽  
Practical Applications ◽  
Polymerase Chain

Quantitative real-time polymerase chain reaction (qPCR) assays were developed and validated in combination with enrichment culture for the detection and discrimination of Erysipelothrix rhusiopathiae and other Erysipelothrix species from tissue samples. The targets for SYBR green qPCR assays were the 16S ribosomal RNA gene for Erysipelothrix species and a gene involved in capsular formation for E. rhusiopathiae. The specificity of the assays was assessed with Erysipelothrix species and other related bacterial species. The limit of detection was found to be 5 colony-forming units per reaction. Amplification of DNA extracted from spleen and joint samples spiked with increasing quantities of Erysipelothrix cells was shown to be equally sensitive to DNA extracted from a pure bacterial culture. The assays were evaluated with 88 tissue samples from 3 experimentally infected pigs and 50 mice and with 36 tissue samples from 3 naturally infected pigs and 11 noninfected pigs. Results were compared with those of direct qPCR and conventional culture. The qPCR after enrichment increased the diagnostic sensitivity over that of culture and qPCR, thereby significantly reducing the total time taken for the detection of E. rhusiopathiae and other Erysipelothrix species. Therefore, this technique could be used for practical applications.

scholarly journals DETEKSI CLOSTRIDIUM DIFFICILE TOKSIGENIK MENGGUNAKAN UJI CEPAT TOKSIN DAN REAL TIME POLYMERASE CHAIN REACTION (Toxigenic Clostridium Difficile Detection Using Toxin Rapid Test and Real Time Polymerase Chain Reaction)

2018 ◽  
Vol 22 (1) ◽  
pp. 22
Author(s):  
Ika Yasma Yanti ◽  
Dalima Ari Wahono Astrawinata
Keyword(s):  
Polymerase Chain Reaction ◽  
Clostridium Difficile ◽  
Antibiotic Therapy ◽  
Real Time ◽  
Real Time Pcr ◽  
Rapid Test ◽  
Chain Reaction ◽  
Chi Square ◽  
Polymerase Chain ◽  
Clostridium Difficile Associated Diarrhea

Toxigenic Clostridium difficile infection, causing a Pseudo Membrane Colitis (PMC) and Clostridium Difficile Associated Diarrhea(CDAD) has increased sharply. The largest risk factor is the use of antibiotics. The purpose of this study was to know how to determinethe prevalence and characteristics of subjects with Toxigenic Clostridium difficile and to assess the ability of the toxin rapid test comparedto real-time PCR. Ninety adult subjects with antibiotic therapy more than two (2) weeks were enrolled in this study. The results of toxinrapid test and real-time PCR were presented in a 2x2 table, statistical test used was Chi square. The prevalence of Toxigenic Clostridiumdifficile based on the toxin rapid test and by real-time PCR was 27.3% and 37.5%, respectively. There were significant differences betweenstool consistency and number of antibiotics used with the detection of Toxigenic Clostridium difficile. There was a relationship betweenthe duration of antibiotic therapy with the detection of Toxigenic Clostridium difficile using real-time PCR (p=0.010, RR=2.116). Thesensitivity, specificity, PPV, NPV, PLR and NLR rapid test against real-time PCR were 69.7%; 98.2%; 95.8%; 84.4%; 39.2 and 0.31,respectively. This study concluded that the prevalence of Clostridium difficile in RSCM was higher compared to that in Malaysia, Thailandand India; the subjects with antibiotic therapy for more than four (4) weeks had a double risk to have Toxigenic Clostridium difficilethan subjects with antibiotic therapy for less than that time (4 weeks). Thus, in this study, toxin rapid test could be used as a tool todetect Toxigenic Clostridium difficile.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Quantitative Real-Time Polymerase Chain Reaction Detection of BK Virus Using Labeled Primers

2010 ◽  
Vol 134 (3) ◽  
pp. 444-448 ◽  
Author(s):  
Zhengming Gu ◽  
Jianmin Pan ◽  
Matthew J. Bankowski ◽  
Randall T. Hayden
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Quantitative Polymerase Chain Reaction ◽  
Bk Virus ◽  
Clinical Samples ◽  
Quantitative Detection ◽  
Chain Reaction ◽  
Pcr Method ◽  
Polymerase Chain

Abstract Context.—BK virus infections among immunocompromised patients are associated with disease of the kidney or urinary bladder. High viral loads, determined by quantitative polymerase chain reaction (PCR), have been correlated with clinical disease. Objective.—To develop and evaluate a novel method for real-time PCR detection and quantification of BK virus using labeled primers. Design.—Patient specimens (n = 54) included 17 plasma, 12 whole blood, and 25 urine samples. DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science, Indianapolis, Indiana); sample eluate was PCR-amplified using the labeled primer PCR method. Results were compared with those of a user-developed quantitative real-time PCR method (fluorescence resonance energy transfer probe hybridization). Results.—Labeled primer PCR detected less than 10 copies per reaction and showed quantitative linearity from 101 to 107 copies per reaction. Analytical specificity of labeled primer PCR was 100%. With clinical samples, labeled primer PCR demonstrated a trend toward improved sensitivity compared with the reference method. Quantitative assay comparison showed an R2 value of 0.96 between the 2 assays. Conclusions.—Real-time PCR using labeled primers is highly sensitive and specific for the quantitative detection of BK virus from a variety of clinical specimens. These data demonstrate the applicability of labeled primer PCR for quantitative viral detection and offer a simplified method that removes the need for separate oligonucleotide probes.

Sign in / Sign up

Export Citation Format

Share Document