scholarly journals Research Note. New data on plant parasitic nematode Longidorus distinctus Lamberti, Choleva & Agostinelli, 1983 (Nematoda: Longidoridae) from Poland

2017 ◽  
Vol 54 (2) ◽  
pp. 179-182
Author(s):  
F. W. Kornobis ◽  
U. Sobczyńska
Keyword(s):  
Parasitic Nematode ◽  
Sequence Data ◽  
Soil Samples ◽  
Research Note ◽  
Parasitic Nematodes ◽  
Distribution Map ◽  
Plant Parasitic Nematodes ◽  
Its1 Sequence ◽  
The Family ◽  
Plant Parasitic

SummaryDuring a survey on the occurrence of the plant parasitic nematodes of the family Longidoridae in Poland, 925 soil samples were taken. Longidorus distinctus was present in 10 (1.08 %) of these samples. In this Research Note we provide: 1) distribution map of these populations, 2) morphometric data, 3) sequence data for D2-D3 28S rDNA and (partial)18S-ITS1 -5.8S(partial) markers and 4) LdistFOR primer (5′-GGCTGTAAAGATATATGCGT-3’) effective in obtaining ITS1 sequence for the species. Morphometric similarities and dissimilarities with data on other published populations are discussed.

scholarly journals First Report of Trichodorus obtusus on Turfgrass in North Carolina, U.S.A.

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 291-291 ◽  
Author(s):  
W. Ye ◽  
Y. Zeng ◽  
J. Kerns
Keyword(s):  
North Carolina ◽  
South Carolina ◽  
Sequence Data ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Body Width ◽  
Cervical Papilla ◽  
Stubby Root Nematode ◽  
Plant Parasitic

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.

Molecular biodiversity assessment of plant-parasitic nematodes in Dokdo Island, Korea

Nematology ◽  
2019 ◽  
Vol 21 (3) ◽  
pp. 275-292 ◽  
Author(s):  
Dongwoo Kim ◽  
Hwal-Su Hwang ◽  
Jae-Kyoung Shim ◽  
JiYoung Yang ◽  
Jae Hong Pak ◽  
...  
Keyword(s):  
Parasitic Nematode ◽  
Rhizosphere Soil ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Biodiversity Assessment ◽  
Plant Parasitic Nematodes ◽  
Species Diagnosis ◽  
Molecular Biodiversity ◽  
Natural Monument ◽  
Plant Parasitic

Summary Dokdo Island has a unique biodiversity that has been preserved as a natural monument. Although the biodiversity of Dokdo has been investigated, little information is available regarding the nematodes. The diversity of plant-parasitic nematodes was investigated using both ITS and D2-D3 sequences. Nematodes extracted from 59 rhizosphere soil samples were morphologically identified as belonging to eight genera: Geocenamus, Helicotylenchus, Rotylenchulus, Heterodera, Paratylenchus, Pratylenchus, Pratylenchoides and Xiphinema. Further, nucleotide sequences were determined from 85 individuals of different genera for species diagnosis. We identified 13 species, including three species of the genus Pratylenchus (P. crenatus, P. kumamotoensis and P. neglectus), Helicotylenchus sp. 1, Rotylenchulus sp. 1, Paratylenchus nanus, Heterodera trifolii, Heterodera spp., Pratylenchoides ritteri, Geocenamus sp. 1, Geocenamus sp. 2, Xiphinema brevicollum and Xiphinema sp. 1. The dominant plant-parasitic nematode on Dokdo was P. crenatus, which was found in 25.4% of the samples. Our study provides important information about the biodiversity of plant-parasitic nematodes on Dokdo Island.

scholarly journals Survey of Plant-Parasitic Nematodes Associated with Yams in Ogun and Osun States of Nigeria

2008 ◽  
Vol 48 (4) ◽  
pp. 421-428 ◽  
Author(s):  
Ayodele Adegbite ◽  
Jelili Saka ◽  
Gideon Agbaje ◽  
Felix Osuloye
Keyword(s):  
Local Government ◽  
Random Sampling ◽  
Parasitic Nematode ◽  
Soil Samples ◽  
Plant Parasitic Nematode ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Ogun State ◽  
Plant Parasitic

Survey of Plant-Parasitic Nematodes Associated with Yams in Ogun and Osun States of NigeriaA survey was conducted to determine the types, frequency and population of plant parasitic nematodes associated with the soils and roots of Yam (Dioscoreaspecies) in all the Local Government Areas of Ogun and Osun States of Nigeria using random sampling soil and root and pie pan modification of Baerman funnel for plant parasitic nematode extraction. Ten and nine genera of plant parasitic nematodes were encountered both from the soils and root samples from the two States. Plant parasitic nematodes recovered includedScutellonemaspp.,Meloidogynespp.,Pratylenchusspp.,Trichodorusspp.,Helicotylenchusspp.,Radopholusspp.,Longidorusspp.,Xiphinemaspp.,Rotylenchulusspp andAphelenchoidesspecies.Scutellonemaspp.,Meloidogynespp., andPratylenchusspp were most widely distributed with frequency ratings of 70, 65 and 60% respectively in soil samples from Ogun State and in the root samples the three genera predominated with 60, 55 and 45% frequency ratings respectively.Meloidogynespp.,Scutellonemaspp., andPratylenchusspp were most widely distributed with frequency ratings of 65, 45 and 35% respectively in soil samples from Osun State and in the root samples the three genera predominated with 55, 35 and 35% frequency ratings respectively.

scholarly journals Draft Genome Sequences of 28 Actinobacteria of the Family Microbacteriaceae Associated with Nematode-Infected Plants

2021 ◽  
Vol 10 (9) ◽  
Author(s):  
Sergey V. Tarlachkov ◽  
Irina P. Starodumova ◽  
Lubov V. Dorofeeva ◽  
Natalia V. Prisyazhnaya ◽  
Tatiana V. Roubtsova ◽  
...  
Keyword(s):  
Comparative Genomics ◽  
Molecular Mechanisms ◽  
Sequence Data ◽  
Draft Genome ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Genome Sequences ◽  
The Family ◽  
Baseline Information ◽  
Plant Parasitic

ABSTRACT Draft genome sequences of 28 strains of Microbacteriaceae from plants infested by plant-parasitic nematodes were obtained using Illumina technology. The sequence data will provide useful baseline information for the development of comparative genomics and systematics of Microbacteriaceae and facilitate understanding of molecular mechanisms involved in interactions between plants and nematode-associated bacterial complexes.

A survey of plant-parasitic nematodes in Illinois corn fields, 2018 and 2020

2021 ◽  
Author(s):  
Jaeyeong Han ◽  
Alison L Colgrove ◽  
Norman Dennis Bowman ◽  
Nathan Schroeder ◽  
Nathan Kleczewski
Keyword(s):  
Parasitic Nematode ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Cyst Nematodes ◽  
Growing Seasons ◽  
Agricultural Community ◽  
Lesion Nematode ◽  
Corn Fields ◽  
Plant Parasitic

One hundred and forty-seven soil samples were collected from corn fields located within 63 Illinois counties during the 2018 and 2020 corn growing seasons. The soil samples were analyzed for frequency and population density of plant-parasitic nematodes. A total of 10 plant-parasitic nematode taxa were identified. Spiral nematode (Helicotylenchus spp.) was the most frequently observed nematode (frequency: 98.6%), followed by lesion nematode (Pratylenchus spp., 85.7%). Other taxa identified included cyst (Heteroderidae, 66.7%), stunt (Tylenchorhynchus spp., 33.3%), lance (Hoplolaimus spp., 29.9%), dagger (Xiphinema spp., 12.9%), pin (Paratylenchus spp., 12.2%), needle (Longidorus spp., 1.4%), stubby-root (Trichodoridae, 1.4%), and ring nematodes (Criconematidae, 0.7%). Nematodes with the greatest population densities included spiral (89 nematodes per 100 cm3 of soil), pin (36), and cyst nematodes (26). Among the 10 nematode taxa, 4.1%, 7.1%, and 2.3% of spiral, lesion, and lance nematodes positive samples exceeded estimated damage thresholds for corn for Illinois, respectively. Results from this survey will help the agricultural community with understanding pathogenic corn nematode populations in the state and prioritize research in this understudied area.

scholarly journals Survey of plant-parasitic and entomopathogenic nematodes in vineyards of Quebec

2005 ◽  
Vol 82 (2) ◽  
pp. 49-55
Author(s):  
G. Bélair ◽  
N. Dauphinais ◽  
Y. Fournier ◽  
H. Mauléon
Keyword(s):  
Entomopathogenic Nematodes ◽  
Parasitic Nematode ◽  
Soil Samples ◽  
Plant Parasitic Nematode ◽  
Steinernema Carpocapsae ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Plant Parasitic

A survey of plant-parasitic and entomopathogenic nematodes associated with vineyards was undertaken in the Estrie and Montérégie regions, the two major grapevine-producing areas in Quebec. Soil samples from 13 sampled vineyards were analyzed for the occurrence of plant-parasitic and entomopathogenic nematodes. Six genera of plant-parasitic nematodes were observed. The most commonly encountered plant-parasitic nematode genera were Pratylenchus and Paratylenchus, both occurring in 85% of sampled vineyards. No Xiphinema sp. were observed in surveyed vineyards. Entomopathogenic nematodes were recovered from 85% of the samples. Heterorhabditid and steinernematid nematodes were isolated from one and 11 vineyards respectively. Steinernematid isolates were identified as Steinernema carpocapsae.

scholarly journals Surveying for Virus-vectoring Nematodes in Container-grown Blueberry Plants in Oregon

2016 ◽  
Vol 17 (3) ◽  
pp. 175-176 ◽  
Author(s):  
D. Sharma-Poudyal ◽  
C. Fraley ◽  
N. K. Osterbauer
Keyword(s):  
Soil Surface ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Plastic Sheet ◽  
Gravel Bed ◽  
Effective Barrier ◽  
Gravel Layer ◽  
Potting Media ◽  
Plant Parasitic

The goal of this study was to determine the risk of finding virus-vectoring nematodes in containerized blueberry plants placed on gravel. To detect dagger nematode, soil, and potting media samples were collected from blueberry nurseries growing plants in containers using soilless potting media, with the containers placed on a gravel bed or, for one nursery, on a plastic sheet placed on the soil surface. Potting media samples were collected from containers holding plants and soil samples were collected from beneath the gravel or plastic barrier. Nematodes were extracted from all of the samples using sucrose centrifugation. No dagger or other plant parasitic nematodes were detected in any of the samples tested. These results suggest no treatment of soilless potting media is necessary before planting blueberries into containers. Similarly, the gravel layer seems to be an effective barrier for suppressing dagger and other plant parasitic nematodes. Accepted for publication 25 July 2016. Published 8 August 2016.

Diversity and incidence of plant-parasitic nematodes associated with saffron (Crocus sativus L.) in Morocco and their relationship with soil physicochemical properties

Nematology ◽  
2019 ◽  
Vol 22 (1) ◽  
pp. 87-102 ◽  
Author(s):  
Fouad Mokrini ◽  
Salah-Eddine Laasli ◽  
Youssef Karra ◽  
Aicha El Aissami ◽  
Abdelfattah A. Dababat
Keyword(s):  
Physicochemical Properties ◽  
Parasitic Nematode ◽  
Management Strategies ◽  
Plant Parasitic Nematode ◽  
Crocus Sativus ◽  
Parasitic Nematodes ◽  
Soil Physicochemical Properties ◽  
Plant Parasitic Nematodes ◽  
Starting Point ◽  
Plant Parasitic

Summary Saffron (Crocus sativus) fields in Morocco’s Taliouine and Taznakht regions were surveyed between January and April 2018 to study the diversity and incidence of plant-parasitic nematodes and assess the effects of soil physicochemical properties on the nematodes. Fourteen nematode genera were identified in soil and root samples collected from 66 saffron fields. The most common plant-parasitic nematodes in the Taliouine region were Pratylenchus spp. and Helicotylenchus spp. In the Taznakht region, the most common nematodes were Pratylenchus spp., Tylenchorhynchus spp. and Ditylenchus dipsaci. Nematodes, particularly Pratylenchus spp. and Ditylenchus spp., were abundant and frequent throughout the region. Several nematode genera were significantly associated with soil texture and mineral content, indicating that soil properties play an important role in plant-parasitic nematode communities. This description of plant-parasitic nematode assemblages associated with saffron fields in Morocco and their relationship with soil physicochemical properties provides a starting point from which appropriate nematode management strategies can be implemented.

The distribution of Tylenchulus semipenetrans and other parasitic nematodes associated with citrus in northern Victoria

1978 ◽  
Vol 18 (90) ◽  
pp. 148 ◽  
Author(s):  
RH Brown
Keyword(s):  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Tylenchulus Semipenetrans ◽  
Citrus Orchards ◽  
Citrus Nematode ◽  
Plant Parasitic

Citrus orchards in the Cobram district of northern Victoria were surveyed in 1976 for the presence of plant parasitic nematodes; in particular for the citrus nematode Tylenchulus semipenetrans. One hundred and forty-six soil samples were collected from 38 orchards. Nine genera were recorded, the most prevalant being Tylenchulus and Paratrichodorus (95 per cent and 37 per cent respectively, of all samples). T. semipenetrans was present in all orchards sampled. Population levels of T. semipenetrans larvae exceeded 1000 per 500 g of soil in 60 per cent of samples.

Distribution of plant parasitic nematodes in South Australian vineyards

1976 ◽  
Vol 16 (81) ◽  
pp. 588 ◽  
Author(s):  
GR Stirling
Keyword(s):  
Sandy Soil ◽  
Parasitic Nematode ◽  
Parasitic Nematodes ◽  
Wide Spread ◽  
Plant Parasitic Nematodes ◽  
Tylenchulus Semipenetrans ◽  
Meloidogyne Spp ◽  
Citrus Nematode ◽  
Almost All ◽  
Plant Parasitic

Vineyards in all five of South Australia's grapegrowing districts were surveyed for plant parasitic nematodes. Root-knot nematodes (Meloidogyne spp.) occurrcd in four districts, and were present in almost all vineyards with sandy soil in the Riverland, Barossa Valley and Central districts. Four species (M. arenaria, M. hapla, M. incognita and M. javanica) were identified. Citrus nematode (Tylenchulus semipenetrans) was wide-spread in Riverland vineyards, and isolated infestations were found in other districts. Other plant parasitic nematode genera found during the survey were Helicotylenchus, Macroposthonia, Paratrichodorus, Paratylenchus, Prat ylenchus, Tylenchorh ynchus and Xiphinema.

Sign in / Sign up

Export Citation Format

Share Document