Microbial ecology of untreated and copper–chrome–arsenic treated stakes exposed in a tropical soil. 1. The initial invaders

1972 ◽  
Vol 18 (12) ◽  
pp. 1923-1931 ◽  
Author(s):  
H. Greaves
Keyword(s):  
Microbial Ecology ◽  
Early Stage ◽  
Initial Period ◽  
Trichoderma Viride ◽  
Untreated Wood ◽  
Soft Rot ◽  
Eucalyptus Regnans ◽  
Ground Treatment ◽  
Colonization Period ◽  
Copper Chrome Arsenic

A study of the microbial ecology of copper–chrome–arsenic treated and untreated Pinus radiata and Eucalyptus regnans sapwood ground stakes exposed for a total of [Formula: see text] years is currently being made. The results presented in this report cover the initial colonization period during the first 7 months of exposure. Soft rot in the outer layers of both species of untreated wood occurs after only 1 month in the ground. Treatment with CCA prevents the early attack of pine but is not as effective in the eucalypt, nor does it appear to have a significant effect upon the diversity of microorganisms which colonize the two woods. For the first 2 months Penicillia are the predominating members of the population. Trichoderma viride, Paecilomyces fumo-roseus, and Cladosporium spp. are also frequently isolated. At 4 months more active soft-rotting fungi can be isolated, e.g. Chaetomium globosum and Humicola grisea, together with Fusaria and Phycomycetes. Bacteria colonize the stakes at a very early stage, the population changing little over this initial period of the study. Actinomycetes were not isolated until the wood had been in the ground for a month or more after which their importance in the population has steadily increased. Basidiomycetes were microscopically observed in sections of the stakes but have not been isolated to date.

scholarly journals Evaluation of Compressive Strength of Decayed Wood in Magnolia obovata

2010 ◽  
Vol 36 (2) ◽  
pp. 81-85
Author(s):  
Kahoru Matsumoto ◽  
Futoshi Ishiguri ◽  
Kazuya Iizuka ◽  
Shinso Yokota ◽  
Naoto Habu ◽  
...  
Keyword(s):  
Compressive Strength ◽  
Early Stage ◽  
White Rot Fungi ◽  
Brown Rot ◽  
Soft Rot ◽  
White Rot ◽  
Chemical Components ◽  
Cellulose Content ◽  
Magnolia Obovata ◽  
Weight Loss Ratio

To obtain the basic information needed to estimate the degree of decay from compressive strength measured using a Fractometer (CS), relationships between CS and the contents of chemical components were analyzed for Magnolia wood decayed by three types fungi (brown rot, white rot, and soft rot fungi) at various decay levels. Weight loss ratio was significantly, negatively correlated with CS in woods decayed by brown rot and white rot fungi. In addition, a relatively high correlation coefficient was recognized between CS and holocellulose or α-cellulose content, except for wood decayed by soft rot fungus. The results obtained showed that Fractometer can detect the decrease of CS at relatively early stage of decay.

The effect of heat shock on differentiation of germinating conidia of Trichoderma viride

1975 ◽  
Vol 53 (20) ◽  
pp. 2274-2281 ◽  
Author(s):  
Sara Spiegel ◽  
Y. Henis ◽  
I. Chet ◽  
Glenda Messer
Keyword(s):  
Protein Synthesis ◽  
Thermal Treatment ◽  
Oxygen Uptake ◽  
Rna Synthesis ◽  
Early Stage ◽  
Trichoderma Viride ◽  
Ultrastructural Changes ◽  
Duration Of Treatment ◽  
Germ Tubes ◽  
Resistance To Heat

Studies on the germination of Trichoderma viride spores indicate that they lose their resistance to heat at an early stage of germination. Whereas dormant conidia were resistant to 46 °C, the same treatment given 4 h after the onset of germination was lethal to the germinating spores. A milder thermal treatment (45 °C for 10 min) given during the first 2 h of incubation caused a delay both of swelling of conidia and appearance of germ tubes.Sensitivity of spores to heat was dependent on the temperature, duration of treatment, and incubation in a nutrient medium before application of the thermal treatment.Increase in oxygen uptake, rate of protein synthesis, and RNA synthesis were observed 2–3 h after the onset of germination. Ultrastructural changes were first observed after 4 h of germination. Application of the mild thermal treatment during the first 2 h of germination resulted in a delay in the observed increase in oxygen uptake, protein synthesis, swelling, and ultrastructural development, as well as emergence of germ tubes.

scholarly journals PRODUCTS OF AMBER ITEMS FROM THE SETTLEMENTS OF THE PRIMORSKYA CULTURE EASTERN GROUP

2018 ◽  
Author(s):  
Э.Б. Зальцман
Keyword(s):  
Raw Materials ◽  
Early Stage ◽  
Initial Period ◽  
Ceramic Ware ◽  
Waste Products ◽  
Radiocarbon Dates ◽  
Object A ◽  
Eastern Group ◽  
Kaliningrad Region

В ходе исследований поселений приморской культуры шнуровой керамики Прибрежное, Ушаково-1 и Ушаково-3 (Калининградская область) обнаружены украшения из янтаря. Янтарные изделия выявлены в постройках, а также ямах, предположительно интерпретируемых как погребения. Постройки в Прибрежном, в которых обнаружены янтарные украшения, датируются радиоуглеродным методом в интервале 3100–2700 гг. до н. э. (рис. 1). Выделяется объект А из постройки 9, где зафиксировано ожерелье, включающее подвески уплощенной формы, пуговицы линзовидного сечения и диски (рис. 2). В объекте № 60 обнаружено ожерелье, в состав которого входили три кольца и пуговица линзовидного сечения (рис. 3). В объекте № 46 выявлены два фрагмента керамики, включая амфору и обломок янтарной пронизи (рис. 3). В Прибрежном нет никаких свидетельств существования мастерских по изготовлению янтарных изделий. У населения восточной группы приморской культуры выработался особый подход к изготовлению предметов из янтаря. Они производились на сезонных стоянках, в районах сбора янтаря-сырца, после чего готовые изделия или полуфабрикаты переправлялись в крупные поселенческие центры, включая Прибрежное, Ниду, Сухач и др. Предположительно, начало обработки янтаря следует связывать с наиболее ранним этапом существования приморской культуры, который приходится на конец IV – перв. пол. III тыс. до н. э. The excavations of Primorskaya culture settlements Pribrezhnoye, Ushakovo-1 and Ushakovo-3 (Kaliningrad region) have yielded products of amber. Amber items were retrieved from constructions as well as pits, presumably interpreted as burials. Radiocarbon dates from the constructions with amber items in Pribrezhnoye fall within 3100 – 2700 BC (fig. 1). Object A from dwelling 9 is notable for a necklace consisting of flattened pendants, lentoid buttons and discs (fig. 2). Another amber necklace from Object № 60 included 3 rings and lens-shaped button (fig. 3). Two fragments of ceramic and a piece of cylindrical-shaped amber bead were found in Object № 46. All products of amber found in Pribrezhnoye entirely correspond to amber repertoire from the settlements of the late IV – first half of the III mill. BC. Close analogies are revealed also at the settlements Šventoji 6 and 2/4А. The similarity is not limited to amber jewelry. Ceramic ware and stone axes are also similar in their ornaments and shapes. Amber waste products and raw materials have not been found at Pribrezhnoye. There are no traces of amber workshop at the site, which evidences that products of amber were not manufactured at the settlement. The same concerns other large settlements of Primorskaya culture. It means that population of the E astern group of Primorskaya culture worked out a distinctive approach to making items of amber. These were made at seasonal shortterm sites in the areas where raw amber was collected and then half-finished and finished products of amber were transported to large centers including Pribrezhnoye, Nida, Sukhach, etc. Most likely, the initial period of amber working was related to the early stage of the Primorskaya culture which dates back to the end of IV – first half of III mill. BC

scholarly journals Soft rot of Jackfruit (Artocarpus heterophyllus) by Rhizopus artocarpi (Berk. & Broome) Boedijn, in Andhra Pradesh, India.

2018 ◽  
Vol 7 (11) ◽  
pp. 2451
Author(s):  
Duvvi Naveen Babu ◽  
Praveen Kumar Nagadesi ◽  
Suneetha N. N. ◽  
Anil Kumar N.
Keyword(s):  
Andhra Pradesh ◽  
Methanolic Extract ◽  
Early Stage ◽  
Water Extract ◽  
Soft Rot ◽  
Artocarpus Heterophyllus ◽  
Brownish Black ◽  
First Time ◽  
Fungal Extracts ◽  
Fruit Surface

Jack fruit (Artocarpus heterophyllus) is most widely cultivated in Andhra Pradesh, india. It has high nutritional values, medicinal values, rich phytochemical compositions, minerals etc. Such crop plants are infected by soft rot causing fungi by Rhizopus artocarpi (Berk. & Broome) Boedijn, in Andhra pradesh, India. The flowers and fruits are severally damaged by soft rot fungi. So this soft rot fungus was isolated from fruits and identified as R. artocarpi (Berk. & Broome) Boedijn. The soft rot fungus is grown on PDA medium and cultural characters are studied. The antifungal test is done by using fungal extracts from Phelinus noxius and Ganoderma lucidum and leaf extract Prosopis juliflora (Sw.) DC. In early stage of infection, Rhizopus spores deposit on moist fruit surface, get germinates and mycelia grow into the tissues of fruit. The infection produces a layer of black spores on the fruit surface. The fruit becomes soft, watery and brown spots develop on the fruit. In culture on PDA medium it is heavily growing and spreading. It produces sporangia with spores, and then it becomes brownish black with maturity of fungal colony. For biocontrol of soft rot fungi, 20% methanolic extract is more effective than 5, 10, and 15% concentrations. The methanolic extract showed 100% inhibition of both soft rot fungi when compared to water extract. For the first time fungal extracts were used to control the soft rot fungus causing disease in Jackfruits.

scholarly journals Changbin culture on Taiwan: history of investigations and basic characteristics

2018 ◽  
Vol 17 (5) ◽  
pp. 21-29
Author(s):  
A. P. Derevianko ◽  
Yu. A. Azarenko ◽  
S. A. Komissarov
Keyword(s):  
Early Stage ◽  
Initial Period ◽  
Asia Pacific ◽  
Eastern Coast ◽  
Chipped Stone ◽  
New Findings ◽  
Ancient People ◽  
History Of ◽  
Basic Characteristics ◽  
Taiwan History

Purpose. The paper describes the most ancient archaeological culture of Taiwan and its significance for the reconstruction of the early stage of the human society’s development in the region. Results. Changbin, the culture of the Late Paleolithic Age, named after Changbin Township in Taidong County on the eastern coast of the island and its southern extremities where it was discovered. Excavations of the primary site, Baxiandong (Baxian caves; or Pahsientung), started in 1968, with new findings being made nowadays. The Baxian sea-cave samples were tested with radiocarbon measurement to have been dated from 15 to 5 thousand years ago, making earlier dates (around 50,000 years ago) debatable. The bulk of artifacts found includes chipped stone and bone tools, mainly of them are flint scrapers, sharp-edged flake tools, pebble chopping tools, shell scrapers and also tools made of bone, such as wedges, stitching awls and fish hooks. The ancient people, who lived in the caves, hunted, fished and gathered seafood on the coast. Typlogically, the Changbin tools are similar to the Hoabinhian industry. It is possible that Changbinhians came to Taiwan from the Southeast China, but also probably from the Phillipines. At its late stage, the Changbin culture overlaps with the Neolithic Dabenkeng culture (about 5000–2500 years BC), but there is no evidence to any contacts between them. Conclusion. Changbin Culture is extremely important for the understanding of the origin of the first settlements in prehistorical Taiwan. Farther research can bring new results in revealing the features of anthropogenesis on the territory of the Eastern Asia. Detailed reconstruction of the stages of development of this territory, with special attention to the initial settlement of Taiwan, is necessary to understand the basic characteristics of the cultural evolution of the early cultures in the region and can help solve the problem of the spread of a modern anthropological type in ecumene, make possible the identifying the ways of ancient migrations in the Asia-Pacific region. The initial period of studies of Baxian caves made possible to formulate the tasks for the new search, the answers to which will be received within the next stage of the archaeological works, having begun about 10 years ago.

scholarly journals Dynamics of Mouse-Like Rodent Communities in Anthropogenically Disturbed Territories of the Southeast of Western Siberia (Kemerovo Region, Russia)

Zoodiversity ◽  
2020 ◽  
Vol 54 (6) ◽  
pp. 487-492
Author(s):  
Ilyashenko ◽  
Luchnikova ◽  
Danilov ◽  
Kovalevsky ◽  
Zubko
Keyword(s):  
Small Mammals ◽  
Dominant Species ◽  
Continuous Monitoring ◽  
Diversity Index ◽  
Early Stage ◽  
Initial Period ◽  
Taiga Zone ◽  
Dominant Group ◽  
Rodent Communities ◽  
Sørensen Index

We studied the dynamics of mouse-like rodent communities in the area of self-growing vegetation, which had undergone deforestation. The research is based on the results of continuous monitoring conducted from 1978 to 2019. Pitfall traps was the method of catching small mammals during the monitoring period. We used Simpson’s Diversity Index to quantify species diversity. The community similarity was evaluated by the percentage of species through Czekanowski-Sørensen Index. The studies were carried out near the “Azhendarovo” Biological Station (54°45ʹ N, 87°01ʹ E). The results of the studies showed that natural primeval communities of the taiga zone before deforestation were characterized by a multidominant structure. The dominant group included the Alexandromys oeconomus Pallas, 1776, and codominant species are represented by the genus Clethrionomys. A characteristic feature of the small mammals’ population of taiga forests is the preponderance of the Apodemus peninsulae (Thomas, 1907) over the Apodemus agrarius Pallas, 1771. On meadowlands, the genus Microtus voles prevailed. These were largely the Al. oeconomus, which accounted for 43% of all mouse-like rodents. After the deforestation, the structure changed. In the early stage of deforestation, the dominant species among rodents was the Al. oeconomus. The composition of dominant species in the recovering areas of cut-down taiga began to approach to the original state 40 years after the deforestation. Meadow communities followed the path of transformation, having no analogs in the initial period and were characterized by a significant amount of ruderal vegetation.

scholarly journals First report of rhizome rot of banana caused by Klebsiella variicola in India

Plant Disease ◽  
2021 ◽  
Author(s):  
Murugan Loganathan ◽  
Raman Thangavelu ◽  
Pushpakanth P ◽  
Muthubharathi Kalimuthu ◽  
R Ramesh ◽  
...  
Keyword(s):  
Tamil Nadu ◽  
Early Stage ◽  
Soft Rot ◽  
Rpob Gene ◽  
Universal Primers ◽  
Biochemical Tests ◽  
First Report ◽  
Rot Disease ◽  
Biochemical Analyses ◽  
Rhizome Rot

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5′ - AGAGTTTGATCCTGGCTCAG - 3′; 1492 R 5′ - GGTTACCTTGTTACGACTT - 3′) and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch’s postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

A Longitudinal Study of Stuttering in Children

1992 ◽  
Vol 35 (4) ◽  
pp. 755-760 ◽  
Author(s):  
Ehud Yairi ◽  
Nicoline Ambrose
Keyword(s):  
Longitudinal Research ◽  
Early Stage ◽  
Initial Period ◽  
Group Differences ◽  
First Year ◽  
Treatment Results ◽  
Testing Period ◽  
The Mean ◽  
Several Intervals ◽  
Post Onset

The objectives of this pilot study were to establish methods for longitudinal research of stuttering in children and to provide preliminary data on the variations that occur in disfluencies during the developmental course of stuttering. Twenty-seven preschool-aged children were followed for a minimum of 2 years shortly after they began stuttering. Tape-recorded speech samples were obtained from the children at several intervals during this period. The number of various types of disfluencies was counted in the speech samples obtained in each testing period. Twenty-one children continued to be followed for varying periods of up to 12 years. Eighteen of the 27 subjects received a few speech treatment sessions during the initial period of the study, whereas 9 children did not receive direct treatment. Results indicated that for the two subgroups there was a marked deceleration over time in the mean frequency of stuttering-like disfluencies. Individual subjects’ data showed considerable variability in the longitudinal development of disfluency but most subjects followed the patterns of the group means. Much of the reduction took place during the early stage of the disorder, especially near the end of the first year post-onset. There were indications that group differences between chronic and recovering stutterers become distinct by approximately 20 months post-onset.

scholarly journals Cervical cytology and associated factors among tribal women of Karnataka, India

PLoS ONE ◽  
2021 ◽  
Vol 16 (3) ◽  
pp. e0248963
Author(s):  
Supriti Ghosh ◽  
Sanjay M. Pattanshetty ◽  
Sneha D. Mallya ◽  
Deeksha Pandey ◽  
Vasudeva Guddattu ◽  
...  
Keyword(s):  
Pap Smear ◽  
Sexual Debut ◽  
Early Stage ◽  
Initial Period ◽  
Well Being ◽  
Cervical Cytology ◽  
Tribal Women ◽  
Younger Age ◽  
Reactive Changes ◽  
Microbial Infections

Background Reproductive well-being is a crucial element of women’s health. Due to the asymptomatic nature of gynaecological morbidities, women rarely seek medical advice in the initial period leading to delayed diagnosis and poor prognosis of subsequent disease. The present study aimed to explore the cervical cytology and its associated risk factors among women from tribal communities of the southern part of coastal Karnataka, India. Methods Papanicolaou (Pap) smear test was performed among 1140 women from three tribal populations, to detect cervical lesions, infections and reactive changes. A semi-structured questionnaire was administered to collect data on socio-demographic and reproductive characteristics of the study population. Results The most predominant gynaecological complaint among the participants was severe lower back ache (77.6%), followed by white discharge per vagina (29.0%) and menstrual irregularities (25.9%). Of the 1140 women screened, 12.4% showed cervical microbial infections, 23.6% were reported to have reactive changes, and 0.2% had epithelial cell abnormalities in the cervix. Cervical microbial infections were found to be associated with younger age group, low socio-economic status and younger age at sexual debut. Conclusion Most of the symptoms suggestive of gynaecological morbidities reported in this study are preventable or treatable. Strengthening ongoing cervical cancer screening programme and implementation of health education programmes among tribal population would be the right policy approach to prevent, detect and treat these symptoms at an early stage and to achieve acceptable health outcomes among tribal women.

scholarly journals A method for the collection of early-stage sea turtle embryos

2020 ◽  
Vol 42 ◽  
pp. 59-65
Author(s):  
A Gárriz ◽  
SA Williamson ◽  
RG Evans ◽  
RD Reina
Keyword(s):  
Embryonic Development ◽  
Early Stage ◽  
Initial Period ◽  
Sea Turtle ◽  
Turtle Species ◽  
Total Rna ◽  
Rna Integrity ◽  
Rna Integrity Number ◽  
Stage Of Development ◽  
Before And After

Early-stage turtle embryos, immediately after oviposition, are very small (<5 mm diameter), hindering research on the initial period of embryonic development. For example, assessing whether turtle eggs had been fertilized and contained a viable embryo at oviposition, especially under field conditions, is complicated by the microscopic size of embryos that may have died at an early stage of development. Further, little is known about the molecular pathways that promote and regulate early developmental processes in turtles, such as pre-ovipositional embryonic arrest. To enable further investigation of the processes critical to early embryonic development in turtle species, a reliable method is required for extraction of early-stage embryos from the egg. Therefore, our aim was to develop a novel and reproducible method for extracting early-stage sea turtle embryos. Herein, we describe the technique for extracting Chelonia mydas embryos before and after white spot formation. Once the embryos were collected, the total RNA of 10 embryos was extracted to validate the method. The total RNA concentration was above 5 ng µl-1 and the RNA integrity number varied between 7.0 and 10.0, which is considered acceptable for further RNA-sequencing analyses. This extraction technique could be employed when investigating fertilization rates of turtle nests and for further investigation of the molecular biology of embryonic development in turtles. Furthermore, the technique should be adaptable to other turtle species or any oviparous species with similar eggs.

Sign in / Sign up

Export Citation Format

Share Document