Co-segregation of the gynomonoecious sex form1 gene (gsf1) of Tripsacum dactyloides (Poaceae) with molecular markers

Genome ◽  
1994 ◽  
Vol 37 (5) ◽  
pp. 809-812 ◽  
Author(s):  
C. A. Blakey ◽  
C. L. Dewald ◽  
E. H. Coe
Keyword(s):  
Molecular Markers ◽  
Molecular Marker ◽  
Single Gene ◽  
Female Parent ◽  
Tripsacum Dactyloides ◽  
Eastern Gamagrass ◽  
Polymorphism Data ◽  
High Degree ◽  
Form Variant ◽  
Linkage Relationships

The only monogenic trait in Tripsacum to date was first identified in the prolific sex form variant Tripsacum dactyloides (L.) L. forma prolificum Dayton et Dewald. The expression of this trait is controlled by the presence of a single-gene, recessive pistillate mutation hereby designated the gynomonoecious sex form1 gene (gsf1), after the registered plant germplasm accession GSF-I (PI483447) from which it was first identified. This trait confers a high degree of feminization to the primarily male floral structure of the Tripsacum rachis. Two molecular markers were found to co-segregate with the gsf1 gene in a diploid (2n = 36) F2 population of Tripsacum dactyloides, where the female parent (GSF-I) had been previously determined to be homozygous recessive for the gene. Phenotypic scoring data were compared with restriction fragment length polymorphism data and linkage relationships were determined. The gsf1 gene is located ~7 cM from tda48, a Tripsacum-derived molecular marker, and ~9 cM from npi286, a maize-derived molecular marker. The marker npi286 also maps within ~5 cM of the tassel seed2 locus (ts2) of maize, which confers a similar change in the inflorescence of the maize tassel.Key words: Tripsacum, gsf1, Eastern gamagrass, ts2, maize.

scholarly journals Applications of molecular markers for bacterial blight resistant varieties in rice (Oryza sativa L.)

2017 ◽  
Vol 9 (4) ◽  
pp. 2309-2314
Author(s):  
A. Premkumar ◽  
Manoj Kumar
Keyword(s):  
Molecular Markers ◽  
Molecular Marker ◽  
Bacterial Blight ◽  
Oryza Sativa L ◽  
Single Gene ◽  
Durable Resistance ◽  
Genetic Resistance ◽  
Recurrent Parent ◽  
Rice Varieties ◽  
Novel Technologies

Bacterial blight is one of devasting disease in almost all rice growing countries. The most effective, eco-nomic and environmental strategy for control of this disease is to develop rice varieties with genetic resistance. However, new pathotype has overcome single gene for resistance in the new cultivars. So, plant breeders are con-centrating to develop high yielding varieties with durable resistance using novel technologies. Molecular marker technology has progressed tremendously in the past decade for genetic improvement of field crops. Molecular markers can improve efficiency of breeding in different ways for trait in segregating population like identify plants with target gene in maximum recovery portion of recurrent parent. The transfer of two or three genes into single variety with the help of molecular marker is expected to lead to more durable resistance. Thus, thus review describes progress made in the development of bacterial blight resistance rice varieties using Marker Assisted Selection.

Genetic Diversity of Basil (Ocimum spp. - Lamiaceae) Based on RAPD Markers and Volatile Oil Constituents

HortScience ◽  
1998 ◽  
Vol 33 (3) ◽  
pp. 492f-493
Author(s):  
Roberto F. Vieira ◽  
James E. Simon ◽  
Peter Goldsbrough ◽  
Antonio Figueira
Keyword(s):  
Genetic Diversity ◽  
Molecular Markers ◽  
Rapd Markers ◽  
Volatile Oil ◽  
Essential Oil Composition ◽  
Oil Composition ◽  
Traditional Medicines ◽  
The Tropics ◽  
High Degree ◽  
First Time

Essential oils extracted from basil (Ocimum spp.) by steam distillation are used to flavor foods, oral products, in fragrances, and in traditional medicines. The genus Ocimum contains around 30 species native to the tropics and subtropics, with some species naturalized and/or cultivated in temperate areas. Interand intraspecific hybridization have created significant confusion in the botanical systematics of this genus. Taxonomy of basil (O. basilicum) is also complicated by the existence of numerous varieties, cultivars, and chemotypes within the species that do not differ significantly in morphology. In this study we are using RAPD markers and volatile oil composition to characterize the genetic diversity among the most economically important Ocimum species. We hypothesize that the genetic similarity revealed by molecular markers will more accurately reflect the morphological and chemical differences in Ocimum than essential oil composition per se. Preliminary research using five Ocimum species, four undetermined species, and eight varieties of O. basilicum (a total of 19 accessions) generated 107 polymorphic fragments amplified with 19 primers. RAPDs are able to discriminate between Ocimum species, but show a high degree of similarity between O. basilicum varieties. The genetic distance between nine species and among 55 accessions within the species O. americanum, O. basilicum, O. campechianum, O. × citriodorum, O. gratissimum, O. kilimandscharium, O. minimum, O. selloi, and O. tenuiflorum will be analyzed by matrix of similarity and compared to the volatile oil profile. This research will for the first time apply molecular markers to characterize the genetic diversity of Ocimum associate with volatile oil constituent.

scholarly journals Analysis of Transcriptional Changes in Different Brassica napus Synthetic Allopolyploids

Genes ◽  
2021 ◽  
Vol 12 (1) ◽  
pp. 82
Author(s):  
Yunxiao Wei ◽  
Guoliang Li ◽  
Shujiang Zhang ◽  
Shifan Zhang ◽  
Hui Zhang ◽  
...  
Keyword(s):  
Gene Expression ◽  
Brassica Napus ◽  
Differentially Expressed Genes ◽  
Expression Patterns ◽  
Female Parent ◽  
Enrichment Analysis ◽  
Differentially Expressed ◽  
Transcriptional Changes ◽  
Aa Genome ◽  
High Degree

Allopolyploidy is an evolutionary and mechanistically intriguing process involving the reconciliation of two or more sets of diverged genomes and regulatory interactions, resulting in new phenotypes. In this study, we explored the gene expression patterns of eight F2 synthetic Brassica napus using RNA sequencing. We found that B. napus allopolyploid formation was accompanied by extensive changes in gene expression. A comparison between F2 and the parent shows a certain proportion of differentially expressed genes (DEG) and activation\silent gene, and the two genomes (female parent (AA)\male parent (CC) genomes) showed significant differences in response to whole-genome duplication (WGD); non-additively expressed genes represented a small portion, while Gene Ontology (GO) enrichment analysis showed that it played an important role in responding to WGD. Besides, genome-wide expression level dominance (ELD) was biased toward the AA genome, and the parental expression pattern of most genes showed a high degree of conservation. Moreover, gene expression showed differences among eight individuals and was consistent with the results of a cluster analysis of traits. Furthermore, the differential expression of waxy synthetic pathways and flowering pathway genes could explain the performance of traits. Collectively, gene expression of the newly formed allopolyploid changed dramatically, and this was different among the selfing offspring, which could be a prominent cause of the trait separation. Our data provide novel insights into the relationship between the expression of differentially expressed genes and trait segregation and provide clues into the evolution of allopolyploids.

MOLECULAR MARKERS APPLIED TO APPLE BREEDING: ANALYSIS OF OLIGOGENIC AND SINGLE GENE RESISTANCES

1998 ◽  
pp. 417-428 ◽  
Author(s):  
L. Gianfranceschi ◽  
N. Seglias ◽  
M. Kellerhals ◽  
C. Gessler
Keyword(s):  
Molecular Markers ◽  
Single Gene ◽  
Apple Breeding

scholarly journals Microsatellite Genetic Markers of Saccharrum spp., and Erianthus sp. on Their Hybrids

2019 ◽  
Vol 3 (1) ◽  
pp. 1
Author(s):  
Mala Murianingrum ◽  
Taryono Taryono ◽  
Rani Agustina Wulandari
Keyword(s):  
Molecular Marker ◽  
Genetic Marker ◽  
Genetic Markers ◽  
Chromosome Segregation ◽  
Molecular Genetic ◽  
Female Parent ◽  
Limiting Factors ◽  
Phenotypic Characteristics ◽  
Saccharum Spp ◽  
Sugarcane Varieties

Progeny identification is the important step that should be done after hybridization. However, polyploidy, aneuploidy and the high chromosome segregation in sugarcane which results various phenotypic characteristics variation and environmental effects become limiting factors to identify the progenies based on morphological characteristic. Microsatellite as one of molecular marker which has codominance inheritance, multiallelic, abundant in the genome and does not influenced by environmental factor is the best tool to asses the crossing fidelity accurately. This research aimed to identify the possibility of genetic marker of Saccharum spp. and Erianthus sp. on their hybrid using microsatellite molecular marker. This study was carried out in Molecular Genetic laboratory, Indonesian Sweetener and Fiber Crops Research Institute (ISFCRI) Malang, from August 2016 to July 2017. Eighty-six (86) F1 intraspecific and interspecific progeny, three commercial sugarcane varieties (PSJT941, PS881 and VMC7616) and two wild types (S. spontaneum dan Erianthus sp.) were assessed genetically by three microsatellite markers. Identification of microsatellite genetic markers was conducted by comparing the visualization band results from electrophoresis of each male and female parent through their progenies. All primers could identify Saccharum spp. and Erianthus sp. genetic markers. There were one to eleven Saccharum spp. and Erianthus sp. genetic markers could be identified such as 2-11 PS881-specific alleles; 2-3 VMC7616-specific alleles; 1-5 PSJT941-specific alleles; two S. spontaneum-specific alleles and 1-2 Erianthus-specific alleles. These findings could be used as the advance genetic marker of microsatellite in sugarcane breeding to asses the cross fidelity.

scholarly journals Assessment of genetic diversity in Indian Barnyard millet (Echinochloa spp. complex) using morphological and molecular markers

2016 ◽  
Vol 8 (3) ◽  
pp. 1643-1648 ◽  
Author(s):  
M. P. Moharil ◽  
Dipti Gawai ◽  
N. Dikshit ◽  
M.S. Dudhare ◽  
P. V. Jadhav
Keyword(s):  
Genetic Diversity ◽  
Molecular Markers ◽  
Genetic Improvement ◽  
Molecular Diversity ◽  
Genetic Relationships ◽  
Barnyard Millet ◽  
Clear Cut ◽  
Cultivated Species ◽  
High Degree

In the present study, morphological and molecular markers (RAPD primers) were used to analyze the genetic diversity and genetic relationships among 21 accessions of Echinochloa spp. complex comprising the wild and cultivated species collected from Melghat and adjoining regions of Vidarbha, Maharashtra. The availability of diverse genetic resources is a prerequisite for genetic improvement of any crop including barnyard millet. A high degree of molecular diversity among the landraces was detected. Among the 21 genotypes, two major groups (A and B) were formed, at 67.28 % similarity, which clearly encompasses 15 accessions of E. frumentacea and 6 accessions of E. colona. Higher similarity was observed in accessions of E. frumentacea. The accessions IC 597322 and IC 597323 also IC 597302 and IC 597304 showed more than 94% similarity among themselves. The classification of genetic diversity has enabled clear-cut grouping of barnyard millet accessions into two morphological races (E. frumentacea and E. colona).

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

Jurnal BIOMA ◽  
2017 ◽  
Vol 13 (1) ◽  
pp. 33-36
Author(s):  
Rini Puspitaningrum ◽  
Ria Amelia ◽  
Adisyahputra Adisyahputra
Keyword(s):  
Molecular Markers ◽  
Glycine Max ◽  
Molecular Marker ◽  
Pcr Amplification ◽  
Housekeeping Gene ◽  
Descriptive Study ◽  
Gene Fragment ◽  
Lectin Gene ◽  
Glycine Max L

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.

scholarly journals Aromatase, oestrogens and human male reproduction

2010 ◽  
Vol 365 (1546) ◽  
pp. 1571-1579 ◽  
Author(s):  
Serge Carreau ◽  
Slaweck Wolczynski ◽  
Isabelle Galeraud-Denis
Keyword(s):  
Leydig Cells ◽  
Single Gene ◽  
Mammalian Species ◽  
Male Reproduction ◽  
Biologically Active ◽  
Human Male ◽  
Final Maturation ◽  
Polymerase Chain ◽  
High Degree

In most mammalian species aromatase is encoded by a single gene ( Cyp19 ), which contains 18 exons, nine of them being translated. In man, the presence of a biologically active aromatase and oestrogen receptors (ERα and ERβ) has been reported in Leydig cells, and also in immature germ cells and ejaculated spermatozoa. Concerning aromatase, the amount of transcript and enzymatic activity are decreased in immotile compared with motile sperm. We have amplified aromatase mRNA by real-time polymerase chain reaction in spermatozoa from asthenospermic, teratospermic and asthenoteratospermic men and recorded, respectively, 44, 52 and 67 per cent decreases of the amount of transcripts compared with fertile donors. A high degree of correlation ( r = −0.64) between the abnormal spermatozoa (especially microcephaly and acrosome malformations) and aromatase/GAPDH transcript ratio has been observed. Idiopathic infertility is a wide health problem and no treatment is currently available. In humans, even if the role of oestrogens in spermatogenesis is still a matter of debate, the observations of decreased sperm number and motility in men genetically deficient in aromatase, together with our data and those reported in the literature, may suggest a role for aromatase/oestrogens not only during the development and maintenance of spermatogenesis but also in the final maturation of spermatozoa.

Sign in / Sign up

Export Citation Format

Share Document