Chromosomal location in common wheat of a gene (Cmcl) from Aegilops squarrosa that conditions resistance to colonization by the wheat curl mite

Genome ◽  
1989 ◽  
Vol 32 (6) ◽  
pp. 1033-1036 ◽  
Author(s):  
E. D. P. Whelan ◽  
J. B. Thomas
Keyword(s):  
Mosaic Virus ◽  
Common Wheat ◽  
Chromosomal Location ◽  
Dominant Gene ◽  
Triticum Aestivum L ◽  
Wheat Streak Mosaic Virus ◽  
D Genome ◽  
Wheat Curl Mite ◽  
Aegilops Squarrosa ◽  
Homozygous Resistant

Wheat streak mosaic is a destructive disease of wheat caused by wheat streak mosaic virus. Wheat streak mosaic virus is vectored by the wheat curl mite (Eriophyes tulipae Keifer). A single dominant gene conditioning resistance to colonization by the mite vector was transferred from Aegilops squarrosa L. to a synthetic amphiploid (AC PGR 16635) and then to common wheat (Triticum aestivum L. em. Thell.) through backcrossing. Because of its origin, the transferred gene was probably located in the D genome. Monosomics 1D through 7D were crossed with a homozygous resistant line with the pedigree Norstar*4/AC PGR 16635. Both 41- and 42-chromosome F1 plants were identified and selfed to obtain F2 seed. The observed proportion of resistant and susceptible plants in 6 of the 7 F2 families from monosomics, and in all 7 of the F2s from disomics, did not deviate significantly from a 3:1 ratio. However, the proportion of resistant plants from the F2 of monosomic 6D was significantly (p < 0.01) in excess of this ratio and susceptible plants from this family were nullisomic for all or part of 6D. In crosses with standard ditelosomic stocks, telocentrics from a ditelosomic derivative of susceptible individual of this F2 paired with 6D(L) but failed to pair with 6D(S). The F2 of heterozygous resistant plants that were monotelodisomic for the long arm of 6D(L) segregated approximately 19 resistant to 1 susceptible, while those from monotelodisomics for the short arm segregated normally (3 resistant to 1 susceptible, p = 0.27). These data show that the gene Cmcl for mite resistance is located on the short arm of chromosome 6D. Key words: Aegilops squarrosa, wheat streak mosaic virus.

Transmission of a wheat alien chromosome translocation with resistance to the wheat curl mite in common wheat, Triticum aestivum L.

1986 ◽  
Vol 28 (2) ◽  
pp. 294-297 ◽  
Author(s):  
E. D. P. Whelan ◽  
R. L. Conner ◽  
J. B. Thomas ◽  
A. D. Kuzyk
Keyword(s):  
Triticum Aestivum ◽  
Common Wheat ◽  
Triticum Aestivum L ◽  
Chromosome Translocation ◽  
Chromosome 6 ◽  
Selfed Progeny ◽  
Wheat Curl Mite ◽  
Aceria Tulipae ◽  
Group 6 ◽  
Homozygous Resistant

A translocation between a common wheat (Triticum aestivum L.) chromosome and chromosome 6 of Elytrigia pontica (Podp.) Holub conferred resistance to feeding by Eriophyes (= Aceria) tulipae Keifer, the mite vector of wheat streak mosaic virus and the wheat spot mosaic agent. Resistance was dominant, but differential transmission occurred between the pollen and the egg. Transmission of resistance through the pollen was low, about 3% in 'Cadet', 'Rescue', and 'Winalta', but significantly higher in 'Norstar' (9.1%). Significant differences also were detected in transmission through the egg. 'Cadet' had the highest transmission (50.9%) and 'Rescue' the lowest (40.5%). However, there were no significant differences among varieties in the frequencies of resistance (50.3–54.5%) in the F2. Less than 10% of the F2 plants were homozygous resistant. Selfed progeny from monosomic or disomic F1 plants from crosses between the homozygous translocation and group-6 monosomics all segregated for susceptibility. Meiotic studies of 25 susceptible F2 plants from these F1 monosomics showed that 21 were either monosomic or disomic and only 4 were nullisomic, indicating that the translocation did not involve any of the group-6 homoeologues. The translocation is considered to be a noncompensating translocation involving a whole arm of chromosome 6 of E. pontica.Key words: wheat, mite (wheat curl), translocation, Triticum.

A spontaneous translocation that transfers wheat curl mite resistance from decaploid Agropyron elongatum to common wheat

Genome ◽  
1988 ◽  
Vol 30 (3) ◽  
pp. 289-292 ◽  
Author(s):  
E. D. P. Whelan ◽  
G. E. Hart
Keyword(s):  
Common Wheat ◽  
Dominant Gene ◽  
Triticum Aestivum L ◽  
Translocation Line ◽  
Structural Genes ◽  
Agropyron Elongatum ◽  
Selfed Progeny ◽  
Wheat Curl Mite ◽  
Group 6 ◽  
Homoeologous Chromosomes

The wheat curl mite (Eriophyes tulipae Keifer) is the vector of wheat streak mosaic virus, a damaging disease of winter wheat. A translocation between a common wheat (Triticum aestivum L.) chromosome and a group 6 chromosome (6Ag) from decaploid Agropyron elongatum (Host) Beauv. resulted in transfer of resistance to colonization by the wheat curl mite. Transmission of resistance through the pollen and the egg were similar and not significantly different from 50%. The frequency of resistance in the F2 generation (65.6%) was lower than expected for a single, dominant gene. In the F2, 26.7% of the resistant plants were homozygous for resistance. Selfed progeny from monosomic and disomic F1 plants from crosses between the translocation line and monosomics for 6A and 6B segregated with frequencies similar to normal F2 progeny but the progeny of monosomics for 6D were primarily resistant (93.2%). Crosses between the translocation line and chromosome 6D telocentrics and studies of four enzymes that are encoded by genes on the group 6 homoeologous chromosomes showed that the translocated chromosome consists of the q arm of chromosome 6D of 'Rescue' and the p arm of chromosome 6 of A. elongatum. Because the new stock was derived from a double monosomic, the translocation was probably a Robertsonian fusion of misdivided centromeres. The resistance is being backcrossed into winter wheat.Key words: Agropyron elongatum, Thinopyron, Elytrigia, Lophopyrum, Robertsonian translocation, isozyme structural genes, wheat curl mite.

Wheat Curl Mite Resistance: Interactions of Mite Feeding With Wheat Streak Mosaic Virus Infection

2011 ◽  
Vol 104 (4) ◽  
pp. 1406-1414 ◽  
Author(s):  
M. Murugan ◽  
P. Sotelo Cardona ◽  
P. Duraimurugan ◽  
A. E. Whitfield ◽  
D. Schneweis ◽  
...  
Keyword(s):  
Virus Infection ◽  
Mosaic Virus ◽  
Wheat Streak Mosaic Virus ◽  
Wheat Curl Mite ◽  
Mite Feeding ◽  
Mosaic Virus Infection

scholarly journals Barley Stripe Mosaic Virus (BSMV) Induced MicroRNA Silencing in Common Wheat (Triticum aestivum L.)

PLoS ONE ◽  
2015 ◽  
Vol 10 (5) ◽  
pp. e0126621 ◽  
Author(s):  
Jian Jiao ◽  
Yichun Wang ◽  
Jonathan Nimal Selvaraj ◽  
Fuguo Xing ◽  
Yang Liu
Keyword(s):  
Triticum Aestivum ◽  
Mosaic Virus ◽  
Common Wheat ◽  
Triticum Aestivum L ◽  
Barley Stripe Mosaic Virus

scholarly journals Comparative Mapping of Genes for Brittle Rachis in Triticum

2011 ◽  
Vol 41 (No. 2) ◽  
pp. 39-44 ◽  
Author(s):  
N. Watanabe ◽  
N. Takesada ◽  
Y. Fujii ◽  
P. Martinek
Keyword(s):  
Triticum Turgidum ◽  
Aegilops Tauschii ◽  
Dominant Gene ◽  
Introgression Line ◽  
Triticum Aestivum L ◽  
Grass Species ◽  
Brittle Rachis ◽  
D Genome ◽  
Adaptive Value ◽  
Group 3

The brittle rachis phenotype is of adaptive value in wild grass species because it causes spontaneous spike shattering. The genes on the homoeologous group 3 chromosomes determine the brittle rachis in Triticeae. A few genotypes with brittle rachis have also been found in the cultivated Triticum. Using microsatellite markers, the homoeologous genes for brittle rachis were mapped in hexaploid wheat (Triticum aestivum L.), durum wheat (Triticum turgidum L. conv. durum /Desf./) and Aegilops tauschii Coss. On chromosome 3AS, the gene for brittle rachis, Br<sub>2</sub>, was linked with the centromeric marker, Xgwm32, at the distance of 13.3 cM. Br<sub>3 </sub>was located on chromosome 3BS and linked with the centromeric marker,<br />Xgwm72 (14.2 cM). Br<sub>1 </sub>was located on chromosome 3DS. The distance from the centromeric marker Xgdm72 was 23.6 cM. The loci Br<sub>1</sub>, Br<sub>2</sub> and Br<sub>3</sub> determine disarticulation of rachides above the junction of the rachilla with the rachis so that a fragment of rachis is attached below each spikelet. The rachides of Ae. tauschii are brittle at every joint, so that the mature spike disarticulates into barrel type. The brittle rachis was determined by a dominant gene, Br<sup>t</sup>, which was linked to the centromeric marker, Xgdm72 (19.7 cM), on chromosome 3DS. A D-genome introgression line, R-61, was derived from the cross Bet Hashita/Ae. tauschii, whose rachis disarticulated as a wedge type. The gene for brittle rachis of R-61, tentatively designated as Br<sup>61</sup>, was distally located on chromosome 3DS, and was linked with the centromeric marker, Xgdm72 (27.5 cM). We discussed how the brittle rachis of R-61 originated genetically. &nbsp; &nbsp;

scholarly journals A Dominant Gene for Resistance to Wheat Streak Mosaic Virus in Winter Wheat Line CO960293-2

Crop Science ◽  
2011 ◽  
Vol 51 (1) ◽  
pp. 5-12 ◽  
Author(s):  
Huangjun Lu ◽  
Jacob Price ◽  
Ravindra Devkota ◽  
Charlie Rush ◽  
Jackie Rudd
Keyword(s):  
Winter Wheat ◽  
Mosaic Virus ◽  
Dominant Gene ◽  
Wheat Streak Mosaic Virus ◽  
Wheat Line

Controlling Wheat Curl Mite and Wheat Streak Mosaic Virus with Systemic Insecticide1234

1979 ◽  
Vol 72 (6) ◽  
pp. 854-855 ◽  
Author(s):  
T. L. Harvey ◽  
T. J. Martin ◽  
C. A. Thompson
Keyword(s):  
Mosaic Virus ◽  
Wheat Streak Mosaic Virus ◽  
Wheat Curl Mite

scholarly journals First Report of Wheat streak mosaic virus in Slovakia

Plant Disease ◽  
2008 ◽  
Vol 92 (9) ◽  
pp. 1365-1365 ◽  
Author(s):  
O. Kúdela ◽  
M. Kúdelová ◽  
S. Nováková ◽  
M. Glasa
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Mosaic Virus ◽  
Direct Sequencing ◽  
Sandwich Elisa ◽  
Triticum Aestivum L ◽  
Wheat Streak Mosaic Virus ◽  
Natural Occurrence ◽  
First Report ◽  
Sequence Identities

The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5′ GAGAGCAATACTGCGTGTACG 3′ and WS-8909R 5′ GCATAATGGCTCGAAGTGATG 3′) designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.

scholarly journals Incidence of Wheat streak mosaic virus, Triticum mosaic virus, and Wheat mosaic virus in Wheat Curl Mites Recovered from Maturing Winter Wheat Spikes

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 318-323 ◽  
Author(s):  
E. Byamukama ◽  
S. Tatineni ◽  
G. Hein ◽  
J. McMechan ◽  
S. N. Wegulo
Keyword(s):  
Winter Wheat ◽  
Mosaic Virus ◽  
Great Plains ◽  
Triticum Aestivum L ◽  
The United States ◽  
Wheat Streak Mosaic Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Wheat Seedlings ◽  
Geographical Regions ◽  
Sticky Tape

Wheat curl mites (WCM; Aceria tosichella) transmit Wheat streak mosaic virus (WSMV), Triticum mosaic virus (TriMV), and Wheat mosaic virus (WMoV) to wheat (Triticum aestivum L.) in the Great Plains region of the United States. These viruses can be detected in single, double, or triple combinations in leaf samples. Information on incidence of viruses in WCM at the end of the growing season is scant. The availability of this information can enhance our knowledge of the epidemiology of WCM-transmitted viruses. This research was conducted to determine the frequency of occurrence of WSMV, TriMV, and WMoV in WCM populations on field-collected maturing wheat spikes and to determine differences in WCM densities in three geographical regions (southeast, west-central, and panhandle) in Nebraska. Maturing wheat spikes were collected from 83 fields across Nebraska in 2011 and 2012. The spikes were placed in proximity to wheat seedlings (three- to four-leaf stage) in WCM-proof cages in a growth chamber and on sticky tape. WCM that moved off the drying wheat spikes in cages infested the wheat seedlings. WCM that moved off wheat spikes placed on sticky tape were trapped on the tape and were counted under a dissecting microscope. At 28 days after infestation, the wheat plants were tested for the presence of WSMV, TriMV, or WMoV using enzyme-linked immunosorbent assay and multiplex polymerase chain reaction. WSMV was the most predominant virus detected in wheat seedlings infested with WCM from field-collected spikes. Double (TriMV+WSMV or WMoV+WSMV) or triple (TriMV+ WMoV +WSMV) virus detections were more frequent (47%) than single detections (5%) of TriMV or WSMV. Overall, 81% of the wheat seedlings infested with WCM tested positive for at least one virus. No significant association (P > 0.05) was found between regions for WCM trapped on tape. These results suggest that WCM present on mature wheat spikes harbor multiple wheat viruses and may explain high virus incidence when direct movement of WCM into emerging winter wheat occurs in the fall.

Sign in / Sign up

Export Citation Format

Share Document