IDENTITY OF THE WHEAT CHROMOSOMES REPLACED BY AGROPYRON CHROMOSOMES IN A TRIPLE ALIEN CHROMOSOME SUBSTITUTION LINE IMMUNE TO WHEAT STREAK MOSAIC

1970 ◽  
Vol 12 (1) ◽  
pp. 145-150 ◽  
Author(s):  
Ruby I. Larson ◽  
T. G. Atkinson
Keyword(s):  
Triticum Aestivum ◽  
Mosaic Virus ◽  
Growth Habit ◽  
Triticum Aestivum L ◽  
Wheat Streak Mosaic Virus ◽  
Substitution Line ◽  
Alien Chromosome ◽  
Chromosome Substitution ◽  
Agropyron Elongatum ◽  
Chromosome Substitution Line

A derivative of Triticum aestivum L. emend Thell. cultivar Rescue3 (2n = 42) × Agropyron elongatum (Host.) Beauv. (2n = 70) is immune to wheat streak mosaic virus Marmor virgatum McK., has 21 pairs of chromosomes, and hybridizes readily with wheat. By crossing with lines ditelosomic for known chromosomes it was determined that Agropyron chromosomes have replaced wheat chromosomes 4D, 5D, and 6D. In growth habit the immune line is like Rescue, but its long slender spikes, absence of awns, and small, slender, blue seeds resemble Agropyron.

Transmission of a chromosome from decaploid Agropyron elongatum that confers resistance to the wheat curl mite in common wheat

Genome ◽  
1988 ◽  
Vol 30 (3) ◽  
pp. 293-298 ◽  
Author(s):  
Ernest D. P. Whelan
Keyword(s):  
Triticum Aestivum ◽  
Common Wheat ◽  
Triticum Aestivum L ◽  
Alien Chromosome ◽  
Chromosome Substitution ◽  
Agropyron Elongatum ◽  
Wheat Curl Mite ◽  
Aceria Tulipae ◽  
Group 6 ◽  
Meiotic Analyses

One of the group 6 chromosomes from Agropyron elongatum (Host) Beauv. confers resistance to colonization by the wheat curl mite (Aceria tulipae Keifer). The transmission of this chromosome was evaluated when added to or substituted for the group 6 homoeologues in two cultivars of common wheat (Triticum aestivum L.). Female transmission of the alien chromosome was similar for all substitutions (8.9%) but significantly less than expected. Male transmission (39.7%) differed among the substituted chromosomes and also was lower than expected except for the substitution involving chromosome 6A. These reduced transmission frequencies were reflected in lower than expected resistance in the F2 progeny. Both male (14.5%) and female (5.2%) transmission of the alien chromosome were reduced in monosomic additions. Meiotic analyses detected all expected F2 cytotypes but some of their frequencies differed among the substituted chromosomes. A possible wheat –alien translocation was detected in BC1F1 progeny.Key words: Agropyron elongatum, Thinopyrum, Elytrigia, Lyphopyrum, wheat curl mite, chromosome substitution.

Natural outcrossing in wheat substitution lines

1977 ◽  
Vol 28 (5) ◽  
pp. 763 ◽  
Author(s):  
RJ Redden
Keyword(s):  
Triticum Aestivum ◽  
Gel Electrophoresis ◽  
Triticum Aestivum L ◽  
Substitution Line ◽  
Intermediate Phenotype ◽  
Starch Gel Electrophoresis ◽  
Chromosome Substitution ◽  
Substitution Lines ◽  
Chromosome Substitution Lines ◽  
Starch Gel

The frequency of natural outcrossing in two chromosome substitution lines of wheat (Triticum aestivum L. em. Thell) was estimated with one procedure and in a third substitution line with another method. The first procedure utilized a dominant inhibitor of awns as the marker to detect outcrosses in the progeny of an awned line. This trial was repeated at five locations. Segregation tests indicated that up to 80 (0.32%) awnless outcrosses were present in an estimated sample of 25,450 progeny. The second method measured outcrossing between a substitution line and two unrelated varieties by observing the intermediate phenotype of the F1 spike. Confirmation of hybridity was obtained for each plant by using starch gel electrophoresis on the endosperm of five F2 seeds from the intermediate F1 spike. This method indicated 0.16% natural outcrossing.

Effects of an intercultivaral chromosome substitution on winterhardiness and vernalization in wheat.

Genetics ◽  
1988 ◽  
Vol 119 (2) ◽  
pp. 453-456
Author(s):  
R S Zemetra ◽  
R Morris
Keyword(s):  
Winter Wheat ◽  
Growth Habit ◽  
Wheat Cultivar ◽  
Triticum Aestivum L ◽  
Segregation Ratio ◽  
Substitution Line ◽  
Winter Survival ◽  
Winter Wheat Cultivar ◽  
Vernalization Gene ◽  
Chromosome 3B

Abstract During a study on the genetic control of winterhardiness in winter wheat (Triticum aestivum L. group aestivum), a gene that affected vernalization was found on chromosome 3B in the winter wheat cultivar ;Wichita.' When chromosome 3B from Wichita was substituted into the winter wheat cultivar ;Cheyenne,' the resultant substitution line exhibited a spring growth habit. This is unusual since a cross between the cultivars Wichita and Cheyenne results in progeny that exhibit the winter growth habit. The F(2) plants from a cross of the 3B substitution line to Cheyenne, the recipient parent, segregated 3:1 for heading/no heading response in the absence of vernalization (chi(2) = 2.44). Earliness of heading appeared to be due to an additive effect of the 3B gene as shown by the segregation ratio 1:2:1 (early heading-later heading-no heading) (chi(2) = 2.74). This vernalization gene differs from previously described vernalization genes because, while dominant in a Cheyenne background, its expression is suppressed in Wichita. The gene may have an effect on winter hardiness in Wichita. In a field test for winter survival the 3B substitution line had only 5% survival, while Wichita and Cheyenne had 50 and 80% survival, respectively. No other substitution line significantly reduced winter survival. The difference between Wichita and Cheyenne in winterhardiness may be due to the vernalization gene carried on the 3B chromosome.

scholarly journals Barley Stripe Mosaic Virus (BSMV) Induced MicroRNA Silencing in Common Wheat (Triticum aestivum L.)

PLoS ONE ◽  
2015 ◽  
Vol 10 (5) ◽  
pp. e0126621 ◽  
Author(s):  
Jian Jiao ◽  
Yichun Wang ◽  
Jonathan Nimal Selvaraj ◽  
Fuguo Xing ◽  
Yang Liu
Keyword(s):  
Triticum Aestivum ◽  
Mosaic Virus ◽  
Common Wheat ◽  
Triticum Aestivum L ◽  
Barley Stripe Mosaic Virus

Effect of the 5R(5A) Alien Chromosome Substitution on the Growth Habit and Winter Hardiness of Wheat

2004 ◽  
Vol 40 (7) ◽  
pp. 810-812 ◽  
Author(s):  
T. T. Efremova ◽  
L. I. Laikova ◽  
V. S. Arbuzova ◽  
O. M. Popova
Keyword(s):  
Growth Habit ◽  
Winter Hardiness ◽  
Alien Chromosome ◽  
Chromosome Substitution

Inheritance of the blue aleurone trait in diverse wheat crosses

Genome ◽  
1990 ◽  
Vol 33 (4) ◽  
pp. 525-529 ◽  
Author(s):  
V. D. Keppenne ◽  
P. S. Baenziger
Keyword(s):  
Triticum Aestivum ◽  
Genetic Marker ◽  
Dominant Gene ◽  
Triticum Aestivum L ◽  
Progeny Testing ◽  
Seed Color ◽  
Male Sterile ◽  
Agropyron Elongatum ◽  
Doubled Haploidy ◽  
Wheat Lines

The blue aleurone trait has been suggested as a useful genetic marker in wheat (Triticum aestivum L.). However, little information is available on its transmission in diverse backgrounds and on its use to identify hybrid seed. UC66049, a hexaploid spring wheat with a spontaneous translocation that included the gene for the blue aleurone trait (Ba) from Agropyron elongatum (Host) P.B. (synonymous with Elytrigia pontica (Podp.) Holub), was crossed to seven wheat cultivars to test the transmission of the trait. UC66049 was crossed to male-sterile red wheat lines to evaluate the blue aleurone trait as a marker for confirming hybridity. Ba segregated as a dominant gene that was transmitted normally through the male and female gametes. For 6 of 7 crosses with diverse pedigrees, we experienced problems with misclassification of the aleurone color in the F2 seed generation, determined by the F3 seed family data. The blue aleurone trait is a good genetic marker; however, progeny testing may be needed to confirm the F2 genotypes in some environments or genetic backgrounds. Moreover, Ba is useful in determining the amount of controlled hybridity as opposed to self-fertility and (or) outcrossing in genetic male-sterile wheat lines. The use of Ba to confirm doubled haploidy was proposed.Key words: Agropyron elongatum, seed color, genetics, Triticum aestivum, Elytrigia pontica.

scholarly journals First Report of Wheat streak mosaic virus in Slovakia

Plant Disease ◽  
2008 ◽  
Vol 92 (9) ◽  
pp. 1365-1365 ◽  
Author(s):  
O. Kúdela ◽  
M. Kúdelová ◽  
S. Nováková ◽  
M. Glasa
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Mosaic Virus ◽  
Direct Sequencing ◽  
Sandwich Elisa ◽  
Triticum Aestivum L ◽  
Wheat Streak Mosaic Virus ◽  
Natural Occurrence ◽  
First Report ◽  
Sequence Identities

The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5′ GAGAGCAATACTGCGTGTACG 3′ and WS-8909R 5′ GCATAATGGCTCGAAGTGATG 3′) designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.

Sign in / Sign up

Export Citation Format

Share Document