First report of Angiostrongylus vasorum in coyotes in mainland North America

2018 ◽  
Vol 183 (24) ◽  
pp. 747-747 ◽  
Author(s):  
Jenna Marie Priest ◽  
Donald T Stewart ◽  
Michael Boudreau ◽  
Jason Power ◽  
Dave Shutler
Keyword(s):  
North America ◽  
Angiostrongylus Vasorum ◽  
First Report

First Report of Powdery Mildew of Lycium chinense (Chinese Matrimony Vine) Caused by Arthrocladiella mougeotii in the Pacific Northwest

2004 ◽  
Vol 5 (1) ◽  
pp. 16
Author(s):  
Dean A. Glawe
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Medicinal Plant ◽  
Pacific Northwest ◽  
Morphological Features ◽  
Lycium Chinense ◽  
First Report ◽  
Landscape Plant ◽  
The Pacific ◽  
Plant Grown

Chinese matrimony-vine (Lycium chinense Mill.) is a traditional medicinal plant grown in China and used as a perennial landscape plant in North America. This report documents the presence of powdery mildew on L. chinense in the Pacific Northwest and describes and illustrates morphological features of the causal agent. It appears to be the first report of a powdery mildew caused by Arthrocladiella in the Pacific Northwest. Accepted for publication 10 November 2004. Published 8 December 2004.

scholarly journals First report of Fusarium proliferatum causing rot of garlic bulbs in North America

2003 ◽  
Vol 52 (3) ◽  
pp. 426-426 ◽  
Author(s):  
F. M. Dugan ◽  
B. C. Hellier ◽  
S. L. Lupien
Keyword(s):  
North America ◽  
Fusarium Proliferatum ◽  
First Report

First report of Verticillium dahliae Kleb. causing wilt symptoms in canola (Brassica napus L.) in North America

2017 ◽  
Vol 39 (4) ◽  
pp. 514-526 ◽  
Author(s):  
Sheau-Fang Hwang ◽  
Stephen E. Strelkov ◽  
Hafiz U. Ahmed ◽  
Qixing Zhou ◽  
Heting Fu ◽  
...  
Keyword(s):  
Brassica Napus ◽  
North America ◽  
Verticillium Dahliae ◽  
Brassica Napus L ◽  
First Report ◽  
Verticillium Dahliae Kleb

scholarly journals First Report of Southern tomato virus on Tomatoes in Southwest France

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
T. Candresse ◽  
A. Marais ◽  
C. Faure
Keyword(s):  
North America ◽  
Seed Transmission ◽  
The United States ◽  
High Rate ◽  
Reference Sequence ◽  
Tomato Mosaic Virus ◽  
Potential Contribution ◽  
First Report ◽  
Tomato Sample ◽  
Potential Pathogenicity

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5′ CTGGAGATGAAGTGCTCGAAGA 3′ and STV-rev 5′ TGGCTCGTCTCGCATCCTTCG 3′) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

scholarly journals First Report of Tomato spotted wilt virus in Blackberry Lily in North America

Plant Disease ◽  
2003 ◽  
Vol 87 (1) ◽  
pp. 102-102 ◽  
Author(s):  
S. Adkins ◽  
L. Breman ◽  
C. A. Baker ◽  
S. Wilson
Keyword(s):  
North America ◽  
Tomato Spotted Wilt Virus ◽  
Amino Acid Sequences ◽  
South Florida ◽  
N Gene ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
First Report ◽  
Tomato Spotted Wilt ◽  
Wilt Virus

Blackberry lily (Belamcanda chinensis (L.) DC.) is an herbaceous perennial in the Iridaceae characterized by purple-spotted orange flowers followed by persistent clusters of black fruit. In July 2002, virus-like symptoms including chlorotic ringspots and ring patterns were observed on blackberry lily leaves on 2 of 10 plants in a south Florida ornamental demonstration garden. Inclusion body morphology suggested the presence of a Tospovirus. Tomato spotted wilt virus (TSWV) was specifically identified by serological testing using enzyme-linked immunosorbent assay (Agdia, Elkhart, IN). Sequence analysis of a nucleocapsid (N) protein gene fragment amplified by reverse transcription-polymerase chain reaction (RT-PCR) with primers TSWV723 and TSWV722 (1) from total RNA confirmed the diagnosis. Nucleotide and deduced amino acid sequences of a 579 base pair region of the RT-PCR product were 95 to 99% and 95 to 100% identical, respectively, to TSWV N-gene sequences in GenBank. Since these 2-year-old plants were grown on-site from seed, they were likely inoculated by thrips from a nearby source. Together with a previous observation of TSWV in north Florida nursery stock (L. Breman, unpublished), this represents, to our knowledge, the first report of TSWV infection of blackberry lily in North America although TSWV was observed in plants of this species in Japan 25 years ago (2). References: (1) S. Adkins, and E. N. Rosskopf. Plant Dis. 86:1310, 2002. (2) T. Yamamoto and K.-I. Ohata. Bull. Shikoku Agric. Exp. Stn. 30:39, 1977.

scholarly journals First record of Pilularia americana A. Braun (Polypodiidae, Salviniales, Marsileaceae) from Peru

Check List ◽  
2018 ◽  
Vol 14 (2) ◽  
pp. 319-322
Author(s):  
Blanca León ◽  
Hamilton Beltrán ◽  
Carlos Carrasco-Badajoz ◽  
Edwin Portal-Quicaña ◽  
Mariela Huaycha-Allcca
Keyword(s):  
North America ◽  
First Record ◽  
First Report ◽  
Aquatic Fern

The aquatic fern Pilularia americana A. Braun is known from several countries in South and North America. Here we provide a first report of this species for Peru, from 2 localities in the Ancash and Ayacucho regions (central Peru), which confirm its presence in the national flora.

scholarly journals First report of the western conifer seed bug, Leptoglossus occidentalis Heidemann, 1910 (Hemiptera, Coreidae) in Paraguay

2021 ◽  
Vol 8 (2) ◽  
pp. 12-14
Author(s):  
Bolívar R. Garcete-Barrett ◽  
◽  
Sergio D. Rios ◽  
Sergio Galeano ◽  
◽  
...  
Keyword(s):  
North America ◽  
Western North America ◽  
First Report ◽  
Leptoglossus Occidentalis ◽  
Conifer Seed ◽  
First Time ◽  
Western Conifer Seed Bug

The Western conifer seed bug, Leptoglossus occidentalis Heidemann, 1910, native to western North America and in ongoing worldwide expansion, is recorded from Paraguay for the first time.

scholarly journals First Report of a Leaf Spot Caused by Alternaria brassicae on the Invasive Weed Lepidium draba in North America

Plant Disease ◽  
2009 ◽  
Vol 93 (8) ◽  
pp. 846-846 ◽  
Author(s):  
A. J. Caesar ◽  
R. T. Lartey
Keyword(s):  
North America ◽  
Chinese Cabbage ◽  
Leaf Spot ◽  
The United States ◽  
Alternaria Brassicae ◽  
Voucher Specimen ◽  
First Report ◽  
Leaf Spots ◽  
Black Spots ◽  
Lepidium Draba

The exotic, rangeland weed Lepidium draba L., a brassicaceous perennial, is widely distributed in the United States. For example, Oregon contains 100,000 ha of land infested with L. draba (2). Because it is capable of aggressive spread and has the potential to reduce the value of wheat-growing land (4), it is the target of biological control research. The application of multiple pathogens has been advocated for control of other brassicaceous weeds, including the simultaneous application of biotrophic and necrotrophic pathogens (3). In pursuit of this approach, in 2007, we discovered the occurrence of leaf spots on approximately 90% of L. draba plants near Shepherd, MT, which were distinct from leaf lesions caused by Cercospora bizzozeriana (1). The lesions were initially tiny, black spots enlarging over time to become circular to irregular and cream-colored around the initial black spots and sometimes with dark brown borders or chlorotic halos. Conidia from the lesions were light brown, elongate and obclavate, produced singly from short conidia, with 8 to 12 transverse septa, and 2 to 6 longitudinal septa. The spore body measured 25 to 35 × 200 to 250 μm with a beak cell 42 to 100 μm long. On the basis of conidial and cultural characteristics, the fungus was identified as Alternaria brassicae (Berk.) Sacc. Leaf tissues bordering lesions were plated on acidified potato dextrose agar. Colonies on V8 and alfalfa seed agar were black with concentric rings, eventually appearing uniformly black after 10 to 14 days. The internal transcribed spacer region of rDNA was amplified using primers ITS1 and ITS4 and sequenced. BLAST analysis of the 575-bp fragment showed a 100% homology with a sequence of A. brassicae Strain B from mustard (GenBank Accession No. DQ156344). The nucleotide sequence has been assigned GenBank Accession No. FJ869872. For pathogenicity tests, aqueous spore suspensions approximately 105/ml were prepared from cultures grown at 20 to 25°C for 10 to 14 days on V8 agar and sprayed on leaves of three L. draba plants. Inoculated plants were enclosed in plastic bags and incubated at 20 to 22°C for 72 to 80 h. In addition, three plants of the following reported hosts of A. brassicae were inoculated: broccoli, canola, Chinese cabbage, collards, broccoli raab, kale, mustard greens, radish, rape kale, and turnip. Within 10 days, leaf spots similar to those described above developed on plants of radish, canola, Chinese cabbage, and turnip and A. brassicae was reisolated and identified. Control plants sprayed with distilled water remained symptomless. These inoculations were repeated and results were the same. To our knowledge, this is the first report of a leaf spot disease caused by A. brassicae on L. draba in North America. A voucher specimen has been deposited with the U.S. National Fungus Collections (BPI No. 878750A). References: (1) A. J. Caesar et al. Plant Dis. 93:108, 2009. (2) G. L. Kiemnec and M. L. McInnis. Weed Technol. 16:231, 2002. (3) A. Maxwell and J. K. Scott. Adv. Bot. Res. 43:143, 2005. (4) G. A. Mulligan and J. N. Findlay. Can. J. Plant Sci. 54:149, 1974.

scholarly journals First Report of Guignardia citricarpa Associated with Citrus Black Spot on Sweet Orange (Citrus sinensis) in North America

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1225-1225 ◽  
Author(s):  
T. S. Schubert ◽  
M. M. Dewdney ◽  
N. A. Peres ◽  
M. E. Palm ◽  
A. Jeyaprakash ◽  
...  
Keyword(s):  
North America ◽  
Sweet Orange ◽  
Black Spot ◽  
The United States ◽  
Yield Reduction ◽  
Rrna Gene ◽  
Specific Primers ◽  
Oatmeal Agar ◽  
First Report ◽  
Citrus Black Spot

In March 2010, citrus black spot symptoms were observed on sweet orange trees in a grove near Immokalee, FL. Symptoms observed on fruit included hard spot, cracked spot, and early virulent spot. Hard spot lesions were up to 5 mm, depressed with a chocolate margin and a necrotic, tan center, often with black pycnidia (140 to 200 μm) present. Cracked spot lesions were large (15 mm), dark brown, with diffuse margins and raised cracks. In some cases, hard spots formed in the center of lesions. Early virulent spot lesions were small (up to 7 mm long), bright red, irregular, indented, and often with many pycnidia. In addition, small (2 to 3 mm), elliptical, reddish brown leaf lesions with depressed tan centers were observed on some trees with symptomatic fruit. Chlorotic halos appeared as they aged. Most leaves had single lesions, occasionally up to four per leaf. Tissue pieces from hard spots and early virulent spots were placed aseptically on potato dextrose agar (PDA), oatmeal agar, or carrot agar and incubated with 12 h of light and dark at 24°C. Cultures that grew colonies within a week were discarded. Fourteen single-spore cultures were obtained from the isolates that grew slower than the Guignardia mangiferae reference cultures, although pycnidia formed more rapidly in the G. mangiferae cultures (1). No sexual structures were observed. Cultures on half-PDA were black and cordlike with irregular margins with numerous pycnidia, often bearing white cirrhi after 14 days. Conidia (7.1 to 7.8 × 10.3 to 11.8 μm) were hyaline, aseptate, multiguttulate, ovoid with a flattened base surrounded by a hyaline matrix (0.4 to 0.6 μm) and a hyaline appendage on the rounded apex, corresponding to published descriptions of G. citricarpa (anomorph Phyllosticta citricarpa) (1). A yellow pigment was seen in oatmeal agar surrounding G. citricarpa, but not G. mangiferae colonies as previously reported (1,2). DNA was extracted from lesions and cultures and amplified with species-specific primers (2). DNA was also extracted from G. mangiferae and healthy citrus fruit. The G. citricarpa-specific primers produced a 300-bp band from fruit lesions and pure cultures. G. mangiferae-specific primers produced 290-bp bands with DNA from G. mangiferae cultures. The internally transcribed spacer (ITS) of the rRNA gene, translation-elongation factor (TEF), and actin gene regions were sequenced from G. citricarpa isolates and deposited in GenBank. These sequences had 100% homology with G. citricarpa ITS sequences from South Africa and Brazil, 100% homology with TEF, and 99% homology with actin of a Brazilian isolate. Pathogenicity tests with G. citricarpa were not done because the organism infects immature fruit and has an incubation period of at least 6 months (3). In addition, quarantine restrictions limit work with the organism outside a contained facility. To our knowledge, this is the first report of black spot in North America. The initial infested area was ~57 km2. The disease is of great importance to the Florida citrus industry because it causes serious blemishes and significant yield reduction, especially on the most commonly grown ‘Valencia’ sweet orange. Also, the presence of the disease in Florida may affect market access because G. citricarpa is considered a quarantine pathogen by the United States and internationally. References: (1) R. P. Baayen et al. Phytopathology 92:464, 2002. (2) N. A. Peres et al. Plant Dis. 91:525, 2007 (3) R. F. Reis et al. Fitopath Bras. 31:29, 2006.

Sign in / Sign up

Export Citation Format

Share Document