Thermal Modeling for Design Optimization of a Microfluidic Device for Continuous Flow Polymerase Chain Reaction (PCR)

Author(s):  
Sumeet Kumar ◽  
Todd Thorsen ◽  
Sarit Kumar Das

Polymerase Chain Reaction (PCR) is a molecular biological method for the in vitro amplification of nucleic acid molecules which has wide applications in the area of genetics, medicine and biochemistry. The typical three step PCR cycle consists of heating the sample to 90–94 °C to denature double-stranded DNA, cooling down to 50–54 °C to anneal the specific primers to the single stranded DNA and finally increasing the temperature to 70–75 °C for extension of the primers with thermostable DNA polymerase. The temperature sensitivity of the reaction requires precise temperature control and proper thermal isolation of these three zones. In this paper we present the design of a continuous flow PCR microfluidic device with the channels fabricated in (poly) dimethylsiloxane (PDMS) and thin film Platinum Resistance Temperature Detector (RTD) elements fabricated on glass substrate to define the three different temperature zones. The fluidic arrangement has a water jacket layer to minimize evaporation from the porous PDMS walls. A detailed thermo fluidic model of the device is presented to predict the performance and efficacy of the proposed design. Numerical simulations are carried out to find the temperature distribution and temperature gradients in the device and a parametric study is done by varying flow rate, heat flux and channel dimensions in order to optimize the design for achieving temperature isolation and sharp temperature gradients between different zones.

2016 ◽  
Vol 37 (11) ◽  
pp. 1878-1881
Author(s):  
Hanok Kim ◽  
Shinae Suk ◽  
Kwanseop Lim ◽  
Nokyoung Park ◽  
Jong Hoon Hahn

2009 ◽  
Vol 168 (1-2) ◽  
pp. 71-78 ◽  
Author(s):  
Zhang-Run Xu ◽  
Xin Wang ◽  
Xiao-Feng Fan ◽  
Jian-Hua Wang

2013 ◽  
Author(s):  
Γεωργία Κόκκαλη

IntroductionOne of the most difficult aspects in assisted reproductive technology (ART) is the selection of asuitable embryo for transfer to the patient’s uterus, in order to achieve implantation anddevelopment to term. This study was based on the hypothesis that preimplantation embryosmay have different gene expression profiles that characterize their ability to implant in theuterus and develop to a healthy baby at term.The main aim of this study was to investigate molecular markers associated with developmentalcompetence and successful implantation in ART. The primary aim of the study was to developand optimize a blastocyst biopsy method, suitable for application in clinical practice. Thesecondary aim of the study was to investigate the gene expression of beta Human ChorionicGonadotropin (CGβ) in blastocysts and correlate it with their morphology. Previously to thecurrent study, blastocyst biopsy was not implemented in clinical practice and no prior researchon the existence, quantification and standardization of transcripts of CGβ has been performedin blastocysts.MethodologyThe methodology for trophectoderm cell biopsy from blastocysts was developed and optimizedprimary to be a safe technique for the embryo and secondary to ensure biopsy of a sufficientnumber of cells, in order to allow the application of multiple molecular analyses. The blastocystbiopsy method involved three steps: A., opening of a hole in the zona pellucida using lowfrequency laser, B., blastocyst culture to allow trophectoderm cells to herniate from the holeand C., trophectoderm cell dissection of the blastocyst mass by laser ablation.The methodology for the investigation of CGβ gene expression in blastocysts, included RNAisolation, cDNA synthesis, amplification and quantification of CGβ transcripts. Because CGβ isencoded by a cluster of homologous genes (CGβ1, CGβ2, CGβ3, CGβ5, CGβ7, CGβ8),methodology was designed considering the homology between them into groups (A: CGβ1,CGβ2 and B: CGβ3, CGβ5, CGβ7, CGβ8). For group A, real time polymerase chain reaction (RealTime PCR, RT-PCR) was applied and then transcripts were identified using restriction enzymedigestion. For group B, nested polymerase chain reaction (Nested-PCR) was used incombination with polymerase chain reaction temperature decreasing hybridization (Touch-downPCR). Following amplification, the products were sequenced (DNA sequencing) for theiridentification.ResultsThe biopsy technique did not appear to impact on the blastocyst’s ability to reform a blastocoelecavity and continue to grow and hatch from the zona pellucida, as it was shown followingfurther in vitro culture. No blastocyst showed signs of morphological damage at the lightmicroscopic level. Blastocyst biopsy was applied in clinical practice in two steps: A., 49 couples undergoing IVF had a biopsy in 153 blastocysts. The implantation rate per blastocysttransferred was 34.3% and lead to 23 full-term pregnancies (46.9%) with 37 babies born. B.,24 couples undergoing IVF for PGD of monogenic diseases had biopsy in 144 blastocysts. Thediagnosis success rate was 93%, the implantation rate per blastocyst transferred was 40% andlead to 11 full-term pregnancies (50%) with 15 term newborns. Then, a randomized pilot studywas conducted with the aim to evaluate and compare the diagnosis and implantation successrates between patients undergoing blastomere biopsy and blastocyst transfer and those havingtrophectoderm biopsy and blastocyst transfer for the diagnosis of monogenic diseases. Theresults showed that the diagnosis success rate was superior in the blastocyst biopsy group,while implantation and pregnancy rates were not statistically significant between the twogroups.For the study of CGβ expression profiles 45 blastocysts were donated to research, of which 39generated trophectoderm cells cDNA libraries. RT-PCR revealed the presence of CGB3, CGB5,CGB7, CGB8 transcripts in 5 blastocysts. The transcripts CGB5, CGB7, CGB8 were expressed inone hatched and one hatching blastocysts (fair morphology on day 7 post insemination) and thetranscript CGβ3 was expressed in three hatched blastocysts (excellent morphology on day 5/6post insemination). The transcript CGβ1 was identified in one only blastocyst. Four blastocystswere biopsied in order to investigate whether CGβ expression can be detected at the minimallevel of few trophectoderm cells. No transcript was found in trophectoderm cell samples orbiopsied blastocyst proper.DiscussionIn recent years, many new technologies have been introduced in clinical practice of ART.Blastocyst biopsy since its first announcement in 2005, until today, has been adopted andintegrated into the application of preimplantation genetic diagnosis (Kokkali et al., 2005). Asblastocyst biopsy has the advantage of providing adequate number of cells for multipleanalyses, it has been lately used for the PGD for monogenic diseases in combination withhistocompatibility screening (HLA matching) or PGD for monogenic diseases screening forstructural or numerical chromosomal abnormalities. Besides its clinical application, blastocystbiopsy offers great opportunities for research, such as the study for the expression ofpreimplantation genetic profiles for the identification of the single most viable blastocyst amongthe cohort developing in vitro that will enable single blastocyst transfers without a concomitantreduction in pregnancy rates.In this study, we investigated whether the β HCG may be used as a predictive marker ofdevelopmental competence for human embryos. This study showed that CGβ gene expressionwas diverse and heterogeneous between blastocysts. Further studies need to be accomplishedto investigate this further.ConclusionsBlastocyst biopsy was developed and optimized to serve as powerful tool for diagnostics ofhuman diseases or to identify diagnostic markers of competence to develop to term for humanembryos.


2018 ◽  
Author(s):  
Νικόλαος Αρμακόλας

Το πεπτίδιο Ec (PEc) του IGF-1Ec (IGF-1Ec) επάγει την κινητοποίηση των ανθρωπίνων μεσεγχυματικών βλαστικών κυττάρων (hMSC) και ενεργοποιεί την εξωκυτταρική κινάση 1 και 2 (ERK 1/2) διαφόρων κυττάρων. Σκοπός της παρούσας μελέτης ήταν η διερεύνηση της επιδρασης του PEc στην κινητοποίηση και τη διαφοροποίηση των hMSCs, καθώς και η δυνατότητα εφαρμογής του σε συνδυασμό με τον TGF-β1 (TGF-β1) στην επιδιόρθωση του αρθρικού χόνδρου. Τα αποτελέσματα της εξωγενούς χορήγησης του ΡΕc και του ΤGF-β1, ξεχωριστά και σε συνδυασμό, σε hMSCs εκτιμήθηκαν χρησιμοποιώντας trypan blue assay, reverse transcription-quantitative polymerase chain reaction, western blot analysis, Alcian blue staining, wound healing assays και migration/invasion assays. Προσδιορίστηκε ότι το PEc εμπλέκεται στη διαδικασία διαφοροποίησης των hMSCs προς υαλώδη χόνδρο. Η χορήγηση PEc ή / και TGF-β1 σε hMSCs έδειξε συγκρίσιμη εναπόθεση χονδρικής θεμέλειας ουσίας. Ακόμα, η χορήγηση του ΡΕc σε συνδυασμό με τον ΤGF-β1 συσχετίστηκε με μια σημαντική αύξηση στην κινητοποίηση των hMSC σε σύγκριση με την χορήγηση μόνο του TGF-β1 ή του ΡEc (Ρ <0,05). Επομένως, το ΡΕc φαίνεται να διευκολύνει in vitro την κινητοποίηση των hMSC και την διαφοροποίηση τους προς χονδροκύτταρα, ενισχύοντας το ρόλο του ΤGF-β1.


2021 ◽  
Vol 8 (3) ◽  
pp. 316
Author(s):  
Taufik Muhammad Fakih ◽  
Salsabilla Wijaya ◽  
Sani Ega Priani

Beberapa produk seperti obat, makanan, dan kosmetika khususnya kolagen dapat berpotensi mengandung turunan babi sehingga diperlukan adanya analisis kehalalan. . Polymerase Chain Reaction (PCR) merupakan metode yang dapat digunakan untuk melakukan analisis sampel secara molekuler. Tujuan dari penelitian ini adalah mendesain kandidat primer dari gen 12S rRNA babi secara in silico. . Metode yang digunakan adalah penelusuran data gen 12S rRNA melalui situs National Center for Biotechnology Information (NCBI), kemudian sekuen gen 12S rRNA dianalisis menggunakan server web Integrated DNA Technologies (IDT) dan MFEprimer-3.1 untuk dilakukan pemilihan kandidat primer terbaik. Kandidat primer terpilih kemudian diidentifikasi menggunakan server web SnapGene Viewer untuk mengamati kemampuan penempelan kandidat primer pada sekuen target. Pada tahap terakhir dilakukan evaluasi kandidat primer menggunakan server web OligoAnalyzer™ Tool agar diperoleh pasangan kandidat primer terbaik yang memenuhi kriteria primer yang baik. Kandidat primer yang terbaik adalah primer forward rRNA-5 (5’ GTACTACTCGCAACTGCCTAAA 3’) dan primer reverse rRNA-6 (5’GCAAGGGTTGGTAAGGTCTATC 3’) karena memenuhi persyaratan primer ideal. . Dengan demikian, kandidat primer tersebut dapat digunakan untuk karakterisasi sampel secara in vitro menggunakan teknik PCR.


Blood ◽  
1997 ◽  
Vol 90 (2) ◽  
pp. 865-872 ◽  
Author(s):  
Ellen L.W. Kittler ◽  
Stefan O. Peters ◽  
Rowena B. Crittenden ◽  
Michelle E. Debatis ◽  
Hayley S. Ramshaw ◽  
...  

Using a murine bone marrow transplantation model, we evaluated the long-term engraftment of retrovirally transduced bone marrow cells in nonmyeloablated hosts. Male bone marrow was stimulated in a cocktail of interleukin-3 (IL-3), IL-6, IL-11, and stem cell factor (SCF ) for 48 hours, then cocultured on the retroviral producer line MDR18.1 for an additional 24 hours. Functional transduction of hematopoietic progenitors was detected in vitro by reverse transcriptase-polymerase chain reaction (RT-PCR) amplification of multiple drug resistance 1 (MDR1) mRNA from high proliferative potential-colony forming cell (HPP-CFC) colonies. After retroviral transduction, male bone marrow cells were injected into nonablated female mice. Transplant recipients received three TAXOL (Bristol-Myers, Princeton, NJ) injections (10 mg/kg) over a 14-month period. Transplant recipient tissues were analyzed by Southern blot and fluorescence in situ hybridization for Y-chromosome–specific sequences and showed donor cell engraftment of approximately 9%. However, polymerase chain reaction amplification of DNAs from bone marrow, spleen, and peripheral blood showed no evidence of the transduced MDR1 gene. RT-PCR analysis of total bone marrow RNA showed that transcripts from the MDR1 gene were present in a fraction of the engrafted donor cells. These data show functional transfer of the MDR1 gene into nonmyeloablated murine hosts. However, the high rates of in vitro transduction into HPP-CFC, coupled with the low in vivo engraftment rate of donor cells containing the MDR1 gene, suggest that the majority of stem cells that incorporated the retroviral construct did not stably engraft in the host. Based on additional studies that indicate that ex vivo culture of bone marrow induces an engraftment defect concomitantly with progression of cells through S phase, we propose that the cell cycle transit required for proviral integration reduces or impairs the ability of transduced cells to stably engraft.


Sign in / Sign up

Export Citation Format

Share Document