scholarly journals Attractiveness of stone fruits production in the Czech Republic

2010 ◽  
Vol 58 (3) ◽  
pp. 107-118
Author(s):  
Dagmar Kudová
Keyword(s):  
Czech Republic ◽  
Fruit Production ◽  
Stone Fruit ◽  
Average Score ◽  
Stone Fruits ◽  
The Czech Republic ◽  
Fruit Processing ◽  
Fruit Orchards ◽  
Criteria For Evaluation ◽  
Evaluation Matrix

The paper deals with evaluation of attractiveness of stone fruits production in Czech Republic using the industry attractiveness evaluation matrix according to the methodology of Higgins and Vincze (1989). It was identifies the key criteria for evaluation of attractiveness, described in detail and eva­lua­ted from the viewpoint of a producer operating in the stone fruits production industry. According to the data of the Central Institute for Supervising and Testing in Agriculture (OTK ÚKZÚZ) for 2008, 1166 entities (companies and growers) farmed on 21 738 hectares of fruit orchards, of which 6 730 ha were aimed on stone fruit production.Total sales for the production of stone fruits decreased by 34.5 % in the period of 2004–2008. Production of stone fruit can be sold through sales co-operatives, to a fruit processing company or in­de­pen­dent­ly. Czech Ministry of Agriculture and the EU through the State Agricultural Intervention Fund stated a range of support programs under which it is possible to apply for funding. Attractiveness of the production of stone fruit is evaluated as below average; the result of the industry attractiveness evaluation matrix for this sector equals 1.84, which is lower than the average score of 3.00.

scholarly journals The atractiveness of apple production in the Czech Republic

2006 ◽  
Vol 54 (3) ◽  
pp. 47-60 ◽  
Author(s):  
Dagmar Kudová
Keyword(s):  
Czech Republic ◽  
Agricultural Land ◽  
Apple Tree ◽  
Market Price ◽  
Fruit Production ◽  
Apple Trees ◽  
Fruit Consumption ◽  
The Czech Republic ◽  
Apple Production ◽  
Evaluation Matrix

The paper deals with evaluation of attractiveness of apple production in the Czech Republic using the Industry attractiveness evaluation matrix according to the methodology of Higgins and Vincze (1989). It identifies the key criteria for evaluation of attractiveness from five fields: market factors, competition factors, financial and economic factors, technological factors, and socio-political factors. The key criteria are described in detail and evaluated from the viewpoint of a producer operating in the apple production industry. The text comes from the papers from the field of fruit production and apple production published by Kudová (2003, 2004, 2005) and Chládková (2003). Application of these methods on other industries was applied by Žufan et al. (2001) and Tomšík, and Žufan (2004).According to the data of the Division of Perennial Plants of the Central Institutte for Supervising and Testing in Agriculture (CISTA), the number of subjects (firms and growers) operating intensive orchards reaches 1 238 on the area of 18 998 ha. In 2003 the number of subjects was 1 243 on the area of 19 514 ha. The total sales in fruit production were in decline from 1999 to 2005, and the decline of sales of apples grown in intensive orchards in 2005 was 34% in comparison with 2004. In the foreign trade, there significantly prevail imports above exports, and from 2002 to 2004 the imports of apples grew by 220%. The biggest growth of area of orchards was in 2004 – by 211 ha of mature apple-trees, which amounts only for 2% of the total area. In connection with this growth, there grew also the yield. Diversity of the market is based on varietal structure of apple-trees grown. According to the data of CISTA, the current varietal structure is not suitable and its change is very slow. Most of apples are grown in Central Bohemia, which amounts for 11% of the total area, which is more than 2000 ha. We can conclude, that even though the average market price of agricultural land is quite high – 25.76 CZK.m–2, the lands for agricultural use for market production with the area of more than 5 ha have the average price of 5.04 CZK.m–2, which is the country average of the price of agricultural land according to the value index (BPEJ).The costs of establishing an apple-tree orchard amount for CZK 409,000 to CZK 653,000 per hectare – depending on the number of trees per hectare. The average costs of attending an apple-tree orchard are CZK 75.226 per hectare (average for the period of 1998–2003). Profits in this industry are based on selling the harvest through growers-organization or to a cannery, or by storing the fruits in own warehouses (only those with a controlled atmosphere are competitive).Fruit consumption in the Czech Republic is slightly increasing from 1990, and till 2005 it grew by 12.1 kg per person per year (by 18.8%) to the current 76.5 kg per person per year. Apples have an important share on the total fruit consumption, and their consumption grows, as well. The increase in the period of 1990─2005 was 65%. European Union, and the Ministry of Agriculture of the Czech Republic through the State Agricultural Intervention Fund (SZIF) introduce a spectrum of support programmes, in which it is possible to apply for financial support. But it is necessary to emphasize, that many fruit producers are not able to get to these funds because of high administrative demands on filling-in and submitting the proposals.The attractiveness of the Czech apple production is evaluated as below-average; the resulting attractiveness score according to the Industry Attractiveness Evaluation Matrix is 2.41, which means that it is lower than the general average score (3).The paper is a part of solution of the research plan of the Faculty of Business and Economics, MUAF in Brno (No. MSM 6215648904).

Leucostoma cinctum. [Descriptions of Fungi and Bacteria].

1998 ◽  
Author(s):  
V. P. Hayova
Keyword(s):  
Czech Republic ◽  
North America ◽  
Geographical Distribution ◽  
Host Response ◽  
Comparative Anatomy ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Republic Of Georgia ◽  
Conidial State ◽  
Fruit Orchards

Abstract A description is provided for Leucostoma cinctum. Information is included on the disease caused by the organism, its transmission, geographical distribution, and hosts. DISEASE: Leucostoma cinctum, especially in its conidial state, is a well-known pathogen of stone-fruit trees causing necrosis of twigs, perennial Cytospora-canker. The fungus penetrates mainly through the scars, and may result in dieback of branches or even whole trees. Tree susceptibility to L. cinctum is influenced by lesions (Stanova, 1990). Comparative anatomy and host response of peach cultivars inoculated with L. cinctum was studied by Biggs (1986). Resistance of different cultivars of stone-fruit trees to L cinctum has been investigated by many authors (Cociu et al., 1991; Miles et al., 1989; Pedryc & Rozsnyai, 1991). HOSTS: On dead or dying, attached or fallen twigs of the Rosaceae, mainly Prunoideae (Amygdalus, Armeniaca, Cerasus, Persica, Prunus) and rarely other subfamilies of the Rosaceae, including genera such as Cotoneaster, Crataegus, Malus and Pyrus. GEOGRAPHICAL DISTRIBUTION: Asia: Armenia, Republic of Georgia, Iran, Kazakhstan, Russia, Turkmenistan, Uzbekistan. Australasia: Australia. Europe: Czech Republic, France, Germany, Hungary, Italy, Moldova, Rumania, Russia, Slovakia, Spain, Switzerland, Sweden, Turkey, UK, Ukraine, former Yugoslavia. North America: Canada, USA (Idaho, Michigan, New-Jersey, Oregon). TRANSMISSION: Both conidia and ascospores are air-borne, especially under humid conditions. Orange or reddish droplets or tendrils of conidia extruded from conidiomata can be often seen after rain. It is also known that arthropods can carry propagules in stone-fruit orchards (Helton et al., 1988).

scholarly journals Dieback of apricot plantations caused by 'Ca. Phytoplasma prunorum' in Borsod-Abaúj-Zemplén county (Northern-Hungary)

2010 ◽  
pp. 34-41
Author(s):  
Gábor Tarcali ◽  
Emese Kiss ◽  
György J. Kövics ◽  
Sándor Süle ◽  
László Irinyi ◽  
...  
Keyword(s):  
Sour Cherry ◽  
Fruit Trees ◽  
Fruit Production ◽  
Plant Diseases ◽  
Stone Fruit ◽  
Stone Fruits ◽  
The North ◽  
Long Run ◽  
The World ◽  
Fruit Plantations

Plant diseases caused by phytoplasmas have increasing importance in all over the world for fruit growers. Lately, phytoplasma diseases occur on many fruit varieties and responsible for serious losses both in quality and quantity of fruit production. In the long-run these diseases cause destruction of fruit trees. The apricot phytoplasma disease (Ca. Phytoplasma prunorum) was first reported in Europe in 1924 from France. In 1992 the disease has also been identified in Hungary. On the base of growers' signals serious damages of "Candidatus Phytoplasma prunorum" Seemüller and Schneider, 2004 (formerly: European stone fruit yellows phytoplasma) could be observed in different stone fruit plantations in the famous apricot-growing area nearby Gönc town, Northern-Hungary. Field examinations have been begun in 2009 in several stone fruit plantations in Borsod-Abaúj-Zemplén County mainly in Gönc region which is one of the most important apricot growing regions in Hungary, named “Gönc Apricot Growing Area”. Our goals were to diagnose the occurrence of Ca. Phytoplasma prunorum on stone fruits (especially on apricot) in the North-Hungarian growing areas by visual diagnostics and confirm data by laboratory PCR-based examinations. All the 28 collected samples were tested in laboratory trials and at 13 samples from apricot, peach, sour cherry and wild plum were confirmed the presence of phytoplasma (ESFY). On the base of observations it seems evident that the notable losses caused by "Ca. Phytoplasma prunorum" is a new plant health problem to manage for fruit growers, especially apricot producers in Hungary. 

Simultaneous detection and genetic variability of stone fruit viroids in the Czech Republic

2008 ◽  
Vol 124 (2) ◽  
pp. 363-368 ◽  
Author(s):  
M. Hassan ◽  
G. Gomez ◽  
V. Pallás ◽  
A. Myrta ◽  
P. Rysanek
Keyword(s):  
Czech Republic ◽  
Genetic Variability ◽  
Simultaneous Detection ◽  
Stone Fruit ◽  
The Czech Republic

scholarly journals Detection of phytoplasma ESFY in apricot trees using phloem and petioles

2010 ◽  
Vol 41 (No. 4) ◽  
pp. 132-140 ◽  
Author(s):  
T. Nečas ◽  
B. Krška
Keyword(s):  
Czech Republic ◽  
Molecular Detection ◽  
Dna Isolation ◽  
Plant Diseases ◽  
Stone Fruit ◽  
The Czech Republic ◽  
Disease Symptoms ◽  
Tissue Extraction

ESFY phytoplasma (European stone fruit yellows phytoplasma) is nowadays one of the most important plant diseases, especially on apricots and peaches, and it belongs to the list of organisms for which quarantine is required in the Czech Republic. The aim of this study was to determine the best period for tissue extraction and the best technique for ESFY detection. It was also to investigate the possibility of isolating DNA for use in ESFY detection from the leaf-stalks of randomly chosen symptomatic and asymptomatic apricot trees. Results of the amplification of DNA extracted from leaf-stalk and phloem sampled from 2-year old woody shoots during the years 2003 and 2004 were statistically analysed and compared, and visible disease symptoms were simultaneously evaluated and compared to the results of molecular detection. DNA isolation from leaf-stalks can be considered as less significant and reliable than isolation from phloem sampled from 2-year old woody shoots.

scholarly journals Xiphinema simile (Nematoda: Longidoridae) in the Czech Republic and a note on other Xiphinema species

2006 ◽  
Vol 43 (1) ◽  
pp. 43-50 ◽  
Author(s):  
S. Kumari
Keyword(s):  
Czech Republic ◽  
First Record ◽  
The Czech Republic ◽  
Fruit Orchards ◽  
South Moravia

AbstractA nematode survey was carried out in South Moravia and Bohemia (Czech Republic) to assess the occurrence of Xiphinema in the rhizosphere of fruit orchards. Sixty six orchards in South Moravia and seven in Bohemia were studied during the years 2003 and 2004. Four Xiphinema species (X. diversicaudatum, X. pachtaicum, X. simile and X. vuittenezi) were recorded. X. simile constitutes a first record for the nematodes fauna of the Czech Republic.

scholarly journals Serological and molecular detection of Prune dwarf virus infecting stone fruits of Charmahal-va-Bakhtiari province, a central region of Iran

2013 ◽  
Vol 4 (1) ◽  
pp. 4
Author(s):  
Nourolah Soltani ◽  
Jamshid Hayati ◽  
Ghobad Babaei ◽  
Maryam Ebrahim Qomi
Keyword(s):  
Sweet Cherry ◽  
Fruit Trees ◽  
Coat Protein Sequence ◽  
Elisa Test ◽  
Stone Fruit ◽  
Stone Fruits ◽  
Rt Pcr ◽  
Leaf Chlorosis ◽  
Fruit Orchards ◽  
Das Elisa

<em>Prune dwarf</em> virus (PDV) is one of the major positive RNA viruses which cause economical damages in stone fruit trees. The symptoms of PDV vary between different stone fruits namely sour and sweet cherry, almond, peach, apricot and plum including leaf narrowing, leaf chlorosis, vein clearing, mosaic, leaf whitening, leathery leaf, bushy branches and stunt trees. During the years 2011 and 2012, 251 leaf samples were collected for detection of PDV in stone fruit orchards of Charmahal-va-Bakhtiari province. DAS-ELISA test proved PDV presence serologically. Then, total RNA were extracted and tested by two-step RT-PCR which replicated partial and full coat protein sequence of PDV. One hundred and eighty one out of total samples (251 samples) showed PDV infection using serological and two-step RT-PCR assays, hence, incidence of PDV in Charmahal-va-Bakhtiari province was confirmed. This is the first report of PDV in stone fruit orchards of Charmahal-va-Bakhtiari province and in Iran.

scholarly journals First Report of Apricot pseudo-chlorotic leaf spot virus Infecting Plum (Prunus domestica) in the Czech Republic

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 461-461 ◽  
Author(s):  
D. Šafářová ◽  
M. Navrátil ◽  
C. Faure ◽  
T. Candresse ◽  
A. Marais
Keyword(s):  
Czech Republic ◽  
Amino Acid ◽  
Leaf Spot ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Prunus Domestica ◽  
Rt Pcr ◽  
Spot Virus ◽  
The Czech Republic ◽  
Chlorotic Leaf

Apricot pseudo-chlorotic leaf spot virus (APCLSV) is a novel, still poorly known Trichovirus in the family Betaflexiviridae. It is most closely related to Apple chlorotic leaf spot virus (ACLSV) (2,4) and infects stone fruit trees of the Prunus genus. Its presence has so far been detected in apricot, plum, Japanese plum, and peach trees in Italy, Spain, France, Hungary, Turkey, Jordan, and Australia (1,2,4). During the summers of 2008 and 2010, leaf samples of old Czech local plum cultivars were obtained from the Holovousy collection and assessed for the presence of viruses belonging to the Capillovirus, Trichovirus, and Foveavirus genera using the polyvalent degenerate oligonucleotides (PDO) nested reverse transcription (RT)-PCR test (3). Following amplification from total RNAs extracts, the amplicons were cloned and several clones were sequenced for each plant sample. In plum (Prunus domestica) cv. Babce, a mixture of amplicons was observed and BlastN and BlastX analyses of the obtained sequences revealed the presence of ACLSV and APCLSV. The 310-bp APCLSV amplicon (GenBank Accession No. JN790294) showed highest identity (82.9% in nucleotide sequence and 97.1% in amino acid sequence) with the Sus2 isolate of APCLSV (4) and clustered with APCLSV isolates in a phylogenetic analysis. APCLSV infection was further confirmed with an APCLSV-specific RT-PCR assay (4), which yielded a product of the expected 205-bp size (GenBank Accession No. JN653070) with closest homology again to the Sus2 APCLSV isolate (83.4 and 94.3% nucleotide and amino acid identity, respectively). To our knowledge, this finding represents the first detection of APCLSV in domestic plums in the Czech Republic, extending our vision of APCLSV diversity and its geographic distribution. For unknown reasons, APCLSV has almost always been reported in mixed infection with ACLSV (1,2,4) and the situation in cv. Babce does not deviate from this trend. This has greatly hindered the analysis of the pathogenicity of APCLSV, a situation further complicated in the current case because the Babce cultivar was also infected by Plum pox virus. References: (1) M. Barone et al. Acta Hortic. 781:53, 2008. (2) T. Candresse et al. Virus and Virus-Like Diseases of Pome and Stone Fruit Trees. A. Hadidi et al., eds. The American Phytopathological Society, St. Paul, MN, 2011. (3) X. Foissac et al. Phytopathology 95:617, 2005. (4) D. Liberti et al. Phytopathology 95:420, 2005.

scholarly journals First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1537-1537 ◽  
Author(s):  
M. Hassan ◽  
P. Rysanek ◽  
F. Di Serio
Keyword(s):  
Czech Republic ◽  
Stone Fruit ◽  
Reference Sequence ◽  
Mixed Infections ◽  
Rt Pcr ◽  
The Czech Republic ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

Sign in / Sign up

Export Citation Format

Share Document