scholarly journals Detection of phytoplasma ESFY in apricot trees using phloem and petioles

2010 ◽  
Vol 41 (No. 4) ◽  
pp. 132-140 ◽  
Author(s):  
T. Nečas ◽  
B. Krška
Keyword(s):  
Czech Republic ◽  
Molecular Detection ◽  
Dna Isolation ◽  
Plant Diseases ◽  
Stone Fruit ◽  
The Czech Republic ◽  
Disease Symptoms ◽  
Tissue Extraction

ESFY phytoplasma (European stone fruit yellows phytoplasma) is nowadays one of the most important plant diseases, especially on apricots and peaches, and it belongs to the list of organisms for which quarantine is required in the Czech Republic. The aim of this study was to determine the best period for tissue extraction and the best technique for ESFY detection. It was also to investigate the possibility of isolating DNA for use in ESFY detection from the leaf-stalks of randomly chosen symptomatic and asymptomatic apricot trees. Results of the amplification of DNA extracted from leaf-stalk and phloem sampled from 2-year old woody shoots during the years 2003 and 2004 were statistically analysed and compared, and visible disease symptoms were simultaneously evaluated and compared to the results of molecular detection. DNA isolation from leaf-stalks can be considered as less significant and reliable than isolation from phloem sampled from 2-year old woody shoots.

scholarly journals Presence of Arcobacter species in pet cats and dogs in the Czech Republic

2017 ◽  
Vol 61 (No. 8) ◽  
pp. 449-455
Author(s):  
M. Pejchalova ◽  
S. Zabcikova ◽  
L. Silhova ◽  
D. Silha ◽  
I. Brozkova ◽  
...  
Keyword(s):  
Czech Republic ◽  
Gel Electrophoresis ◽  
Dna Isolation ◽  
Human Infection ◽  
Chain Reaction ◽  
The Czech Republic ◽  
Two Samples ◽  
Arcobacter Butzleri ◽  
Polymerase Chain

This study was conducted to evaluate the occurrence of the genus Arcobacter in cats and dogs in the Czech Republic. These animals may be carriers of the bacteria and potential sources of human infection. Oral smears were collected from animals using smear swabs and brushes. Based on previous studies, commercially available DNA kits were used for DNA isolation. Samples were analysed using polymerase chain reaction (PCR) and evaluated using gel electrophoresis. Overall, 178 oral smears were tested, of which 108 were from dogs and 70 were from cats. Out of all smears, five were positive, of which four samples were from dogs and one from a cat. In all five positive cases, PCR confirmed the presence of Arcobacter butzleri. In follow-up sampling, the presence of Arcobacter butzleri was demonstrated in two samples from a dog.

Simultaneous detection and genetic variability of stone fruit viroids in the Czech Republic

2008 ◽  
Vol 124 (2) ◽  
pp. 363-368 ◽  
Author(s):  
M. Hassan ◽  
G. Gomez ◽  
V. Pallás ◽  
A. Myrta ◽  
P. Rysanek
Keyword(s):  
Czech Republic ◽  
Genetic Variability ◽  
Simultaneous Detection ◽  
Stone Fruit ◽  
The Czech Republic

scholarly journals Molecular detection ofBorrelia bissettiiDNA in serum samples from patients in the Czech Republic with suspected borreliosis

2009 ◽  
Vol 292 (2) ◽  
pp. 274-281 ◽  
Author(s):  
Nataliia Rudenko ◽  
Maryna Golovchenko ◽  
Daniel Růzõek ◽  
Natalja Piskunova ◽  
Nadja Mallátová ◽  
...  
Keyword(s):  
Czech Republic ◽  
Molecular Detection ◽  
Serum Samples ◽  
The Czech Republic

scholarly journals The occurence of Peronospora radii de Bary on Argyranthemum frutescens (L.) Schultz-Bip. in the Czech Republic

2007 ◽  
Vol 55 (1) ◽  
pp. 205-210 ◽  
Author(s):  
Ivana Šafránková ◽  
Jiří Müller
Keyword(s):  
Czech Republic ◽  
Downy Mildew ◽  
Lower Surface ◽  
Ornamental Plant ◽  
Shoot Tips ◽  
The Czech Republic ◽  
Disease Symptoms ◽  
Landscape Plant ◽  
Young Leaves

Marguerite daisy (Argyranthemum frutescens) is an ornamental plant, that is used as a potted and landscape plant. In 2006, disease symptoms were observed on marguerite daisy (A. frutescens cv. ‘Butterfly’) in greenhouses in Brno-Tuřany. The pathogen primarily affected newly expanded young leaves and shoot tips. They were chlorotic, twisted and stunted. The affected leaf tips were necrotic. Bud flowers and flowers were deformed and get dry. The extensive purplish brown growth of downy mildew colonized the lower surface of infected leaves. Older leaves were unaffected.

scholarly journals First Report of Apricot pseudo-chlorotic leaf spot virus Infecting Plum (Prunus domestica) in the Czech Republic

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 461-461 ◽  
Author(s):  
D. Šafářová ◽  
M. Navrátil ◽  
C. Faure ◽  
T. Candresse ◽  
A. Marais
Keyword(s):  
Czech Republic ◽  
Amino Acid ◽  
Leaf Spot ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Prunus Domestica ◽  
Rt Pcr ◽  
Spot Virus ◽  
The Czech Republic ◽  
Chlorotic Leaf

Apricot pseudo-chlorotic leaf spot virus (APCLSV) is a novel, still poorly known Trichovirus in the family Betaflexiviridae. It is most closely related to Apple chlorotic leaf spot virus (ACLSV) (2,4) and infects stone fruit trees of the Prunus genus. Its presence has so far been detected in apricot, plum, Japanese plum, and peach trees in Italy, Spain, France, Hungary, Turkey, Jordan, and Australia (1,2,4). During the summers of 2008 and 2010, leaf samples of old Czech local plum cultivars were obtained from the Holovousy collection and assessed for the presence of viruses belonging to the Capillovirus, Trichovirus, and Foveavirus genera using the polyvalent degenerate oligonucleotides (PDO) nested reverse transcription (RT)-PCR test (3). Following amplification from total RNAs extracts, the amplicons were cloned and several clones were sequenced for each plant sample. In plum (Prunus domestica) cv. Babce, a mixture of amplicons was observed and BlastN and BlastX analyses of the obtained sequences revealed the presence of ACLSV and APCLSV. The 310-bp APCLSV amplicon (GenBank Accession No. JN790294) showed highest identity (82.9% in nucleotide sequence and 97.1% in amino acid sequence) with the Sus2 isolate of APCLSV (4) and clustered with APCLSV isolates in a phylogenetic analysis. APCLSV infection was further confirmed with an APCLSV-specific RT-PCR assay (4), which yielded a product of the expected 205-bp size (GenBank Accession No. JN653070) with closest homology again to the Sus2 APCLSV isolate (83.4 and 94.3% nucleotide and amino acid identity, respectively). To our knowledge, this finding represents the first detection of APCLSV in domestic plums in the Czech Republic, extending our vision of APCLSV diversity and its geographic distribution. For unknown reasons, APCLSV has almost always been reported in mixed infection with ACLSV (1,2,4) and the situation in cv. Babce does not deviate from this trend. This has greatly hindered the analysis of the pathogenicity of APCLSV, a situation further complicated in the current case because the Babce cultivar was also infected by Plum pox virus. References: (1) M. Barone et al. Acta Hortic. 781:53, 2008. (2) T. Candresse et al. Virus and Virus-Like Diseases of Pome and Stone Fruit Trees. A. Hadidi et al., eds. The American Phytopathological Society, St. Paul, MN, 2011. (3) X. Foissac et al. Phytopathology 95:617, 2005. (4) D. Liberti et al. Phytopathology 95:420, 2005.

scholarly journals First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1537-1537 ◽  
Author(s):  
M. Hassan ◽  
P. Rysanek ◽  
F. Di Serio
Keyword(s):  
Czech Republic ◽  
Stone Fruit ◽  
Reference Sequence ◽  
Mixed Infections ◽  
Rt Pcr ◽  
The Czech Republic ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

Molecular detection of Toxoplasma gondii in feathered game intended for human consumption in the Czech Republic

2018 ◽  
Vol 286 ◽  
pp. 75-79 ◽  
Author(s):  
Lucie Skorpikova ◽  
Nikol Reslova ◽  
Alena Lorencova ◽  
Radim Plhal ◽  
Jakub Drimaj ◽  
...  
Keyword(s):  
Czech Republic ◽  
Toxoplasma Gondii ◽  
Molecular Detection ◽  
Human Consumption ◽  
The Czech Republic

EPIDEMIOLOGY OF EUROPEAN STONE FRUIT YELLOWS PHYTOPLASMA IN THE CZECH REPUBLIC

2004 ◽  
pp. 483-487 ◽  
Author(s):  
R. Fialová ◽  
M. Navrátil ◽  
P. Válová ◽  
P. Lauterer ◽  
F. Kocourek ◽  
...  
Keyword(s):  
Czech Republic ◽  
Stone Fruit ◽  
The Czech Republic

scholarly journals First report of anthracnose of common snowberry caused by Sphaceloma symphoricarpi in the Czech Republic

2010 ◽  
Vol 42 (No. 4) ◽  
pp. 139-146 ◽  
Author(s):  
V. Kůdela ◽  
V. Krejzar
Keyword(s):  
Czech Republic ◽  
Meteorological Data ◽  
First Record ◽  
The Czech Republic ◽  
Disease Symptoms ◽  
First Report ◽  
Rainy Period

During the first part of July, 2006, a severe outbreak of disease on common snowberry shrubs, <I style="mso-bidi-font-style: normal">Symhoricarpos albus</I> var. <I style="mso-bidi-font-style: normal">laevigata</I>, was observed in some city ornamental parks and small gardens in Prague and its environs. Based on disease symptoms and pathogen characteristics both on leaves, shoots, fruits and in culture, it can be concluded that the outbreak of anthracnose on common snowberry was caused by <I style="mso-bidi-font-style: normal">Sphaceloma symphoricarpi</I> Barus &amp; Horsfall 1928. This is probably the first record of <I style="mso-bidi-font-style: normal">S. symphoricarpi</I> in the Czech Republic. Of the surveyed <I style="mso-bidi-font-style: normal">Symphoricarpos</I> species and varieties, i.e. <I style="mso-bidi-font-style: normal">S. albus </I>var<I style="mso-bidi-font-style: normal">. albus</I>, <I style="mso-bidi-font-style: normal">S. albus</I> var. <I style="mso-bidi-font-style: normal">laevigata,</I> <I style="mso-bidi-font-style: normal">S. orbiculatus</I>, <I style="mso-bidi-font-style: normal">S. doorenbosii, </I>and S. chenaultii</I>, only <I style="mso-bidi-font-style: normal">S. albus</I> var. <I style="mso-bidi-font-style: normal">laevigata </I>was attacked by the pathogen. Common snowberry shrubs having semipendent branches appeared to be more susceptible than shrubs with upright ones. Disease symptoms and pathogen characteristics are described and illustrated. The analysis of meteorological data indicated that the outbreak of anthracnose of common snowberry might have been related with rainy and mild weather during May, and especially with a rainy period of 7 days at the end of May and beginning of June.

Sign in / Sign up

Export Citation Format

Share Document